Labshake search
Citations for Illumina :
401 - 450 of 2326 citations for 2 5 Sulfanyl 4H 1 2 4 triazol 3 yl phenol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... barcoding and sequencing using HiSeq configured for 2×150 bp paired-end reads (Illumina). An average of 28.9 × 106 paired reads was generated per sample with a mean quality score of 35.81 ...
-
bioRxiv - Plant Biology 2022Quote: ... Paired-end reads (2 × 150 bp) were generation on the HiSeq 3000 platform (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... whole SARS-CoV-2 genome cDNA libraries were generated using a MiniSeq system (Illumina) with a MiniSeq mid-output kit ...
-
bioRxiv - Cancer Biology 2023Quote: ... libraries were sequenced 2 x 150 paired end using a NovaSeq 6000 instrument (Illumina) to get 30x coverage on the genome ...
-
bioRxiv - Microbiology 2023Quote: ... Transposon mutant 19_H4 was sent for whole genome sequencing (Illumina; 2 X 151 bp) to identify the insertion site of the transposon.
-
bioRxiv - Bioengineering 2023Quote: ... Libraries were then sequenced on NextSeq 500 Mid Output with 2×150 bp (Illumina). The Cell Ranger VDJ pipeline was used for sample de-multiplexing and barcode processing.
-
bioRxiv - Developmental Biology 2024Quote: ... The resulting sequencing library were performed pair-end sequenced (2 x 150bp) by Illumina NovaSeq instruments at Novogene Bioinformatics Institute ...
-
bioRxiv - Genetics 2024Quote: ... These pooled libraries underwent 2 × 250 bp sequencing (Illumina HiSeq 2500, Psomagen, Rockville, MD).
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of isolated genomic DNA sample and 100 nmol of each primer (WISH_Illumina_fwd and WISH_Illumina_rev ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of isolated genomic DNA sample and 100 nmol of each primer (WISH_Illumina_fwd and WISH_Illumina_rev ...
-
bioRxiv - Neuroscience 2024Quote: ... and pooled equimolar to 2 nM for single-read sequencing on the HiSeq4000 (Illumina) with settings 51-8-8 ...
-
bioRxiv - Microbiology 2024Quote: ... and 2 × 150 nucleotides paired-end sequencing on a HiSeq4000 platform (Illumina Inc., USA) were carried out as communicated previously (Bhattacharya et al ...
-
bioRxiv - Microbiology 2024Quote: ... and passed to paired-end sequencing (2 × 150 bp) on a NovaSeq6000 platform (Illumina). On average ...
-
bioRxiv - Microbiology 2024Quote: ... The samples were paired-end sequenced (2 x 300 bp) on a MiSeq (Illumina) using a MiSeq Reagent kit v3 (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... Paired-end sequencing (2 × 149 bp) was performed on a NextSeq 550 system (Illumina) using high-output flow cells ...
-
bioRxiv - Microbiology 2024Quote: ... The samples were paired-end sequenced (2×300 bp) on a MiSeq (Illumina, USA) using a MiSeq Reagent kit v3 (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... and paired-end sequencing (2 × 300 bp) was conducted via Illumina MiSeq (Illumina, USA) at the Institute of Clinical Molecular Biology (IKMB ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pellet was incubated in the transposase reaction mix (25µL 2×TD buffer (Illumina), 2.5µL transposase (Illumina Cat# FC-121-1030 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Genetics 2021Quote: ... A second PCR step was run to add the index primers for sequencing (NEBNext Multiplex Oligos for Illumina Dual Index Primers Set 1 and 2). PCR products were purified using SPRIselect beads (Beckman ...
-
bioRxiv - Cancer Biology 2020Quote: ... sequencing was run in the rapid run flow cell and paired-end sequenced (read 1 – 26 bp, read 2 – 100 bp) on a HiSeq 1500 (Illumina, San Diego, CA 92122 USA).
-
bioRxiv - Cancer Biology 2023Quote: ... we dispensed 600 nL of tagmentation reaction mix containing Tagmentation DNA buffer (TD) and Amplicon Tagment Mix (ATM) at 2:1 v/v ratio (Nextera kit, Illumina, cat. no. FC-131-1096) into each well and performed tagmentation at 55° C for 5 min followed by hold at 4° C in a PCR thermocycler ...
-
bioRxiv - Neuroscience 2024Quote: ... sequencing was run in the rapid run flow cell and paired-end sequenced (read 1 – 26 bp, read 2 – 100 bp) on a HiSeq 1500 (Illumina, San Diego, CA 92122 USA). To minimize batch effects ...
-
bioRxiv - Systems Biology 2023Quote: ... 200-500 ng DNA was used for genotyping using the Infinium Omni2.5-8v1-4 and the Infinium Omni2.5-8v1-5 Genotyping BeadChip (Illumina) at the UCSD IGM core ...
-
bioRxiv - Genomics 2021Quote: ... GSA version 3 with direct-to-consumer booster by Illumina (Fig. 1). This Customized chip is the intersection of commonly used chips ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries 1-3 (wild type) were sequenced on a NovaSeq 6000 (Illumina) and the mutant library was sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA samples were further processes according to the TruSeq Sample Preparation v.2 Guide (Illumina) and paired end-sequenced on the HiSeq 2500 (Illumina).
-
bioRxiv - Cell Biology 2020Quote: ... Small RNA libraries were diluted to 2 nM and run on a miSeq System (Illumina) for NGS using the V2 kit (Illumina) ...
-
bioRxiv - Genetics 2021Quote: ... Libraries were then sequenced with 2×150bp paired-end reads on an Hiseq3000 instrument (Illumina).
-
bioRxiv - Genetics 2021Quote: ... Libraries were prepared with a TruSeq RNA Library Prep Kit version 2 (Illumina RS-122) and sequenced on an Illumina HiSeq4000 in paired-end mode (PE150).
-
bioRxiv - Evolutionary Biology 2021Quote: ... with 300 cycle mid-output (2×150 bp) NextSeq Reagent kits v2 (Illumina Corporation, 20024905). FASTQ files of raw sequencing data were deposited in NCBI database with the Sequence Read Archive (SRA ...
-
bioRxiv - Developmental Biology 2021Quote: ... followed by paired-end sequencing (2 x 75 bp) performed with Nextseq 500 (Illumina, USA). Libraries were sequenced in triplicate ...
-
bioRxiv - Genomics 2020Quote: ... The samples were then sequenced (2×101 cycles, paried end reads) on the HiSeq2500 (Illumina) using the TruSeq SBS Kit v3-HS 200 cycles Kit (Illumina) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2×150bp paired-end sequencing (PE150) was performed on an Illumina Novaseq™ 6000 (Illumina) following the vendor’s recommended protocol.
-
bioRxiv - Genomics 2020Quote: ... Paired end libraries (2×150 bp) were sequenced on an Illumina HiSeq4000 instrument (Illumina Inc.).
-
bioRxiv - Genomics 2020Quote: ... Paired-reads (2×100 bp) were sequenced on the NovaSeq 6000 S2 flowcell (Illumina, Inc.). DNA and RNA library preparation and sequencing were performed at the SNP&SEQ Technology Platform in Uppsala ...
-
bioRxiv - Microbiology 2020Quote: ... and sequenced as 2 × 150 base pair reads on the Illumina NextSeq 550 instrument (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... and sequenced with 2×250 bp cycles of v2 Miseq chemistry (Illumina, San Diego, CA). Replicate reactions from each sample were pooled and gel purified using the Blue Pippin Prep system (Sage Science ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and small-scale sequencing (2 x146bp) on an iSeq platform (Illumina, San Diego, CA, US). Subsequent equimolar pooling of individual libraries from each plate was performed prior to performing large-scale paired-end sequencing (2 × 146 bp ...
-
bioRxiv - Microbiology 2021Quote: ... and sequenced as 2 × 150 base pair reads on the Illumina NextSeq 550 instrument (Illumina).
-
bioRxiv - Cancer Biology 2020Quote: ... and paired-ended [2×150 bp] sequencing was performed on NovaSeq 6000 sequencing system (Illumina). Once the sequencing run was completed ...
-
bioRxiv - Microbiology 2021Quote: ... 100x coverage using a high-output paired end 2 x 150 sequencing regent kit (Illumina).
-
bioRxiv - Synthetic Biology 2022Quote: ... read length 2 × 175 bp using the MiSeq platform (Illumina Inc., San Diego, CA, USA). The library preparation and sequencing were performed in the Institute of Genomics Core Facility ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 x 150 cycles (NextSeq 500/550 Mid Output v2 kit, Illumina, San Diego, CA).
-
bioRxiv - Developmental Biology 2022Quote: ... 2 sequencing libraries were constructed using TruSeq® Stranded Total RNA Library Prep (20020597, Illumina) kit at the National Cancer Institute’s Center for Cancer Research sequencing core facility ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and sequenced with 2 × 250 base paired-end reads on the Illumina MiSeq platform (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... Each library was then paired end sequenced (2×75bp) on a NextSeq 500 instrument (Illumina).