Labshake search
Citations for Illumina :
4151 - 4200 of 9497 citations for Rat Insulin Like Growth Factor 1 IGF1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... and prepared strand-specific libraries with the TruSeq strand-specific Total RNA kit (Illumina Inc.), which was sequenced on the NextSeq 500 system to obtain 50 million 100bp paired end reads ...
-
bioRxiv - Developmental Biology 2023Quote: ... CUT&Tag assay was performed using NovoNGS CUT&Tag 3.0 High-Sensitivity Kit (for Illumina, Novoprotein scientific Inc. ...
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were sequenced on an NextSeq 550 platform (Illumina, 75 cycles High Output Kit v2.0) and 75-bp paired-end reads were generated ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were prepared from 100 to 400 pg of cDNA using Nextera XT Kit (Illumina), as per the manufacturer’s instructions but with one-fifth volumes for each sample ...
-
bioRxiv - Microbiology 2023Quote: Sequencing libraries were generated using the TruSeq DNA PCR-Free Sample Preparation Kit (Illumina, USA), following the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2023Quote: ... according to the manufacture’s protocol (Vazyme Hyperactive® Universal CUT&Tag Assay Kit for Illumina).
-
bioRxiv - Microbiology 2023Quote: ... according to the qPCR Quantification Protocol Guide (KAPA Library Quantification Kit for Illumina Sequencing platforms), and qualified using the TapeStation D1000 ScreenTape (Agilent Technologies ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA library was generated using the TruSeq small RNA kit (Illumina, San Diego, CA), while the mRNA library was generated using the TruSeq Stranded mRNA poly-A selection kit (Illumina ...
-
bioRxiv - Genomics 2024Quote: ... The sequencing library was prepared using the TruSeq Stranded Total RNA library kit (Illumina, USA) and sequenced on a NextSeq 500 Illumina platform using a paired-end approach of 75 bp.
-
bioRxiv - Microbiology 2024Quote: ... DNA libraries were constructed using the Nextera XT library prep kit (Illumina, San Diego, USA) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... A library was independently prepared with 1ug of total RNA for each sample by Illumina TruSeq Stranded mRNA Sample Prep Kit (#RS-122-2101, Illumina, Inc., San Diego, CA, USA). The first step in the workflow involves purifying the poly-A containing mRNA molecules using poly-T-attached magnetic beads ...
-
bioRxiv - Microbiology 2022Quote: ... Stranded cDNA libraries were generated using the TruSeq Stranded Total RNA Library Prep Kit (Illumina). Prior to sequencing ...
-
bioRxiv - Systems Biology 2022Quote: ... Libraries for Illumina sequencing were prepared with the TruSeq RNA Library Prep Kit v2 (Illumina) and checked for quality using the Fragment Analyzer high-sensitivity NGS kit (AATI) ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA libraries were prepared according to manual of Truseq small RNA library prep kit (Illumina). Deep sequencing (Hiseq4000 ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries were constructed using the TruSeq Nano library kit (Illumina, Inc., San Diego, CA, USA) and shotgun sequencing was performed in four runs using an Illumina HiSeq 2500 ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA libraries were prepared using Nextera XT Library Prep Kit (Illumina, San Diego, USA) following the manufacturer’s protocol with the following modifications ...
-
bioRxiv - Microbiology 2022Quote: Short read NGS libraries were prepared using the Nextera flex DNA Library Prep Kit (Illumina), and 150 bp paired-end sequencing was performed on the NovaSeq 6000 system ...
-
bioRxiv - Microbiology 2023Quote: ... and then indexed using a Nextera XT DNA Library Preparation Kit (Illumina; San Diego, CA). Finally ...
-
bioRxiv - Microbiology 2023Quote: ... The samples were prepared for sequencing using the Nextera XT DNA Library Preparation Kit (Illumina) and paired-end sequenced (2 × 300 bp ...
-
bioRxiv - Microbiology 2023Quote: ... The library was sequenced on the Illumina MiSeq using the MiSeq Reagent Kit v3 (Illumina). Deep sequencing was performed in duplicate for each sample.
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA library preparation was performed using illumina Nextera library perp kit (Illumina, FC-131-1024) with 0.6ng cDNA as input ...
-
bioRxiv - Bioengineering 2023Quote: ... the samples to be pooled were barcoded using the Nextera XT Index Kit v2 (Illumina). The final sequencing libraries were then purified using AMPure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was tagmented using Nextera XT DNA Library Preparation Kit (Illumina catalog #FC-131-1024) and libraries were amplified by PCR as per ATAC-seq libraries above.
-
bioRxiv - Genomics 2023Quote: ... Total RNA-seq was performed using the RiboZero TruSeq Stranded total RNA sequencing kit (Illumina). All RNA-seq experiments were performed in at least biological duplicate.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... DNA was tagmented using Nextera XT DNA library preparation kit (FC-131-1096, Illumina, USA) and dual-indexed with Nextera XT Index Kit V2 Sets A-D (FC-131-2001 ...
-
bioRxiv - Cell Biology 2023Quote: ... and RNA-seq was performed using the Miseq Reagent Kit V2 (MS-102-2001, Illumina).
-
bioRxiv - Genetics 2023Quote: ATAC-seq was performed using the Nextera DNA Library Prep Kit (Illumina FC-121-1030). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... and sequencing libraries were constructed with NEBNext UltraII Directional RNA Library Preparation Kit (Illumina, #E7760) as described previously [65] ...
-
bioRxiv - Developmental Biology 2023Quote: ... and cDNA libraries were generated using the Illumina TruSeq Stranded mRNA Sample Prep Kit (Illumina). Samples were sequenced on the Illumina HiSeq2500 platform as 150-bp single-end reads ...
-
bioRxiv - Immunology 2023Quote: ... Libraries were prepared using an Illumina Stranded mRNA Library Prep kit (Illumina, Cat no. 20040534) with IDT for Illumina RNA Unique Dual Index adapters following the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2023Quote: ... using the Illumina NextSeq 500/550 High Output Kit v2.5 (75 cycles) (Cat. #20024906, Illumina). Target depth was 5 – 10 million reads per sample.
-
bioRxiv - Bioengineering 2023Quote: ... All sequencing was performed using an Illumina NextSeq 75 cycle high-output kit (Illumina 20024906) in a paired end format (38 cycles read 1 + 37 cycles read 2) ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA-seq libraries were prepared using the Illumina TruSeq Stranded mRNA Library Prep Kit (Illumina) according to manufacturer instructions and sequenced on a HiSeq 2500 platform (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purified DNA was used for library preparation using the NEBNext Ultra Library prep Kit (Illumina) according to manufacturer’s instructions with the following Epicypher manufacturer’s modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... and converted to cDNA (NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina). cDNA from each sample was amplified and barcoded in a mild stringency PCR (20 cycles of 30 seconds at 98°C ...
-
Engineering TALE-linked deaminases to facilitate precision adenine base editing in mitochondrial DNAbioRxiv - Molecular Biology 2023Quote: ... RNA libraries were prepared using a TruSeq Stranded Total RNA Library Prep Gold kit (Illumina). RNA library quality was assessed using a 2200 TapeStation with a D1000 ScreenTape system (Agilent) ...
-
bioRxiv - Microbiology 2023Quote: ... one nanogram of DNA was fragmented and adapter ligated using the Nextera XT kit (Illumina) and unique 8bp dual-index adapters (IDT ...
-
bioRxiv - Microbiology 2023Quote: ... Next-generation sequencing libraries were prepared with a Nextera XT kit (Illumina, San Diego, CA), and libraries were sequenced on an Illumina MiSeq using 300-bp paired-end reads ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Immunology 2023Quote: ... an Illumina library was prepared using a Nextera DNA Library Preparation Kit (Illumina, SanDiego, CA) according to SMARTer kit instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced on an Illumina MiSeq using the MiSeq Reagent kit v3 (Illumina, 600 cycles). Individual amplicon pools were extracted from the raw sequencing data using the FASTQ workflow in BaseSpace (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA library was prepared using TruSeq RNA Library Prep Kit v2 (Illumina, RS-122-2001). The sequencing library was quantified and verified using Qubit dsDNA High Sensitivity Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA-Seq libraries were prepared using the TruSeq Stranded mRNA Library Prep kit (Illumina, 2002059). RNA-Seq and ChIP-Seq libraries were quantified on a Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stranded libraries were prepared using a TruSeq Stranded Total RNA Library Prep Gold kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... and tagmented using the enzyme and buffer provided in the Nextera Library Prep Kit (Illumina). Tagmented DNA was purified using the MinElute PCR purification kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and quantified using qPCR (KAPA Biosystems Library Quantification Kit for Illumina platforms P/N KK4824) as previously described (Couturier et al ...
-
bioRxiv - Plant Biology 2023Quote: ... Libraries were constructed by Macrogen using the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina). Libraries were sequenced on an Illumina NovaSeq6000 platform NovaSeq6000 via paired-end sequencing of 150bp reads ...
-
bioRxiv - Genomics 2023Quote: ... nine-cycles of PCR were performed using indexed primers from a Nextera Index kit (Illumina), and amplified DNA was size-selected to a size of <500 bp using AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Biophysics 2023Quote: ... using iSeq 100 i1 reagent v2 kit (300 cycle) 2 x 150 read length (Illumina). The total number of reads were 150,000-400,000 per sample ...
-
bioRxiv - Microbiology 2023Quote: ... 16S rRNA gene sequencing was performed using the Illumina MiSeq Reagent Kit v2 by Illumina MiSeq System (Illumina ...