Labshake search
Citations for Illumina :
351 - 400 of 1689 citations for R 4 5 Isopropylidene 2 pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... 2 x 150 pair-end sequencing was performed using the HiSeq2500 (Illumina) with recommended protocol ...
-
bioRxiv - Genomics 2020Quote: ... with the respiratory virus oligo panel including SARS-CoV-2 probes (Illumina, San Diego ...
-
bioRxiv - Developmental Biology 2020Quote: ... and paired end-sequenced (2×75 bp) on the HiSeq 2500 (Illumina). Experiment 1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The sequencing was outsourced (GENEWIZ Illumina NovaSeq/HiSeq 2×150 bp sequencing), generating a 20 million paired-end reads per replicate ...
-
bioRxiv - Immunology 2020Quote: ... using 2 × 300 bp paired-end kits (Illumina MiSeq Reagent Kit v3). Sequence analysis and assembly of lineage trees were performed using an in-house custom analysis pipeline as previously described (39 ...
-
bioRxiv - Systems Biology 2023Quote: ... The paired-end sequencing (150 bp × 2) was performed with Novaseq6000 (Illumina) by Chemical Dojin Co ...
-
bioRxiv - Microbiology 2023Quote: ... The retained libraries were sequenced using MiSeq V3 (2 × 300 bp) (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were paired-end sequenced (2×75 bp) on a NextSeq500 (Illumina). BclToFastq was used for the preprocessing of the raw data (trimming and filtering) ...
-
bioRxiv - Plant Biology 2023Quote: ... and sequencing was performed using MiSeq 2 × 250 cycle paired-end (Illumina) with the Nano Kits v3 reagent ...
-
bioRxiv - Immunology 2022Quote: ... with the NextSeq 500/550 High Output 2×75 cycles kit (Illumina). All sequenced samples were quality assessed by capillary electrophoresis with the Agilent RNA 2100 Nano kit (Bioanalyzer ...
-
bioRxiv - Cancer Biology 2023Quote: ... or paired-end (2 × 100 bp) on the Novaseq 6000 platform (Illumina).
-
bioRxiv - Genomics 2023Quote: ... the Illumina TruSeq RNA sample preparation kit v.2 (Illumina, CA, USA) was used for library preparation following the low-throughput protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced (paired-end 2×75-bp) in a NextSeq500 instrument (Illumina). Alignment to the reference genome sequence of Listeria monocytogenes EGDe (RefSeq ...
-
bioRxiv - Immunology 2023Quote: ... We sequenced the libraries on 2 lanes of a NovaSeq S4 (Illumina), aligned using CellRanger (10X Genomics ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by the addition of 25 µl of 2× TD buffer (Illumina) and 7.5 µl of Nextra Tn5 transposase (Illumina) ...
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 stocks were deep sequenced on a MiSeq platform (Illumina). SARS-CoV-2 whole-genome amplicon-based sequencing was conducted by adapting an existing whole genome sequencing pipeline for poliovirus genotyping as described (Wang et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... depending on library complexity) or NovaSeq (SP 2×250 cycles) platform (Illumina).
-
bioRxiv - Genomics 2023Quote: ... followed by paired-end sequencing (2 × 150 bp) on a NextSeq2000 (Illumina) instrument ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and sequenced on a HiSeq X (Illumina, paired-end 2 × 150 pb).
-
bioRxiv - Developmental Biology 2024Quote: ... Paired-end reads (2×150 nt) were generated by HiSeq 4000 (Illumina) at the UCSF Center for Advanced Technology (CAT ...
-
bioRxiv - Immunology 2024Quote: ... Sequencing libraries were prepared using 2 × 300 bp paired-end kits (Illumina MiSeq Reagent Kit v3 ...
-
Braf-mutant Schwann cells divert to a repair phenotype to induce congenital demyelinating neuropathybioRxiv - Developmental Biology 2024Quote: ... We sequenced at 2*76 base-pairs on a NovaSeq 6000 (Illumina) (from mouse sciatic nerves ...
-
Braf-mutant Schwann cells divert to a repair phenotype to induce congenital demyelinating neuropathybioRxiv - Developmental Biology 2024Quote: ... or on at 2*101 base-pairs on a NovaSeq 6000 (Illumina) (from hiPSC-derived SC).
-
bioRxiv - Microbiology 2024Quote: ... and sequenced with 2 × 250 bp reads on a MiSeq system (Illumina) at the DNA Sequencing Facility of the American University of Beirut ...
-
bioRxiv - Immunology 2024Quote: ... samples were sequenced at 2×150 bp using NovaSeq 6000 system (Illumina).
-
bioRxiv - Neuroscience 2021Quote: ... and 1.25 µL each of i5 and i7 indexing primers (Illumina, diluted 1:5). The samples were indexed with the following PCR cycles ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Diluted libraries were spiked with 5% Phi-X control (Illumina, San Diego, CA, USA) and sequenced using the Illumina MiSeq (Illumina Inc. ...
-
bioRxiv - Molecular Biology 2022Quote: ATAC-seq was conducted on 5×104 live cells using Nextera Tn5 transposase (Illumina) as previously described (Buenrostro et al. ...
-
bioRxiv - Immunology 2022Quote: ... 5’ expression library was sequenced with NovaSeq 6000 S1 (100 cycles) (Illumina, cat. 20012865) and the V(D)J library was sequenced with NextSeq 500/550 Mid Output Kit v2.5 (300 Cycles ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3,000 U of Quick ligase and 5 nM of annealed adaptor (Illumina truncated adaptor) in a volume of 50 μl and incubated at 25°C for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3,000 units of Quick ligase and 5 nM of annealed adaptor (Illumina truncated adaptor) in a volume of 50 µl and incubated at 25°C for 20 min ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 µL of the Illumina PCR Primer Cocktail (PPC, Illumina FC-121-1030). PCR conditions were as follows ...
-
bioRxiv - Genetics 2020Quote: ... Pooled and denatured library (8 pM) containing 5% volume of PhiX (control library; Illumina) was sequenced using the Illumina MiSeq system with MiSeq Reagent Kit V3 (300-bp paired-end reads ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl Primer Cocktail (Nextera DNA Sample Preparation Kit and Nextera Index Kit, Illumina). Amplification was performed in a Veriti 96 Well Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: ... Library amplification was performed using 5 μL Nextera XT i7 forward index primer (Illumina) and 5 μL custom i5 index primers (2 μM ...
-
bioRxiv - Immunology 2024Quote: ... Sequencing of 5’ gene expression libraries was performed on an Illumina NextSeq 2000 (Illumina) using P3 reagent kits (100 cycles) ...
-
bioRxiv - Microbiology 2024Quote: ... PCR products were sequenced using the llumina NextSeq 550 platform with 5% PhiX (Illumina) spike-in ...
-
bioRxiv - Cancer Biology 2024Quote: ATAC-seq was conducted on 5 × 104 live cells using Nextera Tn5 transposase (Illumina) as previously described 31 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and sequenced on an Illumina HiSeq 2000 sequencer (RRID:SCR_020132, v.4, Illumina, San Diego, California, USA) in 50 bp single-end mode by Genomics and Proteomics Core facility ...
-
bioRxiv - Genomics 2024Quote: ... samples were incubated in cleavage mix (MiSeq Nano kit v2 reagent 4) (Illumina MS-103-1003) for 6 min at 60 °C ...
-
bioRxiv - Microbiology 2022Quote: ... and diluted to 4 nM for sequencing on an Illumina MiSeq (Illumina, San Diego, CA, USA). A 500 cycle MiSeq Reagent kit v2 (Illumina ...
-
bioRxiv - Pathology 2021Quote: ... with the libraries clustered at 12-15pM and mixed with 5% PhiX genomic DNA (Illumina).
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were diluted and mixed with 5-20% phiX control v3 (Illumina FC-110-3001) and sequenced with oSK326 for read 1 and oSK324 for the index read.
-
bioRxiv - Cell Biology 2023Quote: ... and 5-day deligated samples were sequenced (the ligated sample was sequenced on the Illumina Nextseq500 and all others were sequenced on the Illumina Nextseq2000) ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Genomics 2022Quote: ... n = 5 Illumina-sequenced datasets and n = 1 WGS of normal DNA (PBMC, Illumina sequencing). Variants were identified in all datasets using lofreq67 (without filtering ...
-
bioRxiv - Microbiology 2023Quote: ... all libraries were spiked with 5% PhiX Control v3 (Illumina, Catalog No. FC-110-3001). The NCBI Genbank accession number for the raw sequencing data reported here is PRJNA999749.
-
bioRxiv - Genomics 2024Quote: ... were dual-indexed using differing barcode indexes both for the forward (5’ P5 Illumina adapter) and reverse oligos (3’ P7 Illumina adapter) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1,6 pM of libraries with 5% PhiX was then loaded on a NextSeq 500 (Illumina) for a 75 bp paired-end sequencing run at the Research Sequencing Facility of ERIBA (UMCG).