Labshake search
Citations for Illumina :
351 - 400 of 8737 citations for Mouse Meiotic Recombination Protein REC8 Homolog REC8 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... the Ribo-Zero rRNA removal kit (Illumina) was used without deviations from the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using a MiSeq v3 Reagent Kit (Illumina) and 2 × 300 bp paired end sequencing ...
-
bioRxiv - Immunology 2021Quote: ... using the v3 MiSeq Reagent Kit (Illumina). 16S data were analyzed using QIIME 2 (3) ...
-
bioRxiv - Molecular Biology 2021Quote: ... TruSeq SBS Kit v3-HS (Illumina, USA).
-
bioRxiv - Immunology 2020Quote: ... with the Ribo-Zero Gold kit (Illumina) for ribosomal depletion ...
-
bioRxiv - Immunology 2020Quote: ... employing Illumina MiSeq v2 Reagent Kit (Illumina). For the analysis of TCR sequencing data ...
-
bioRxiv - Immunology 2020Quote: ... Indices from the Nextera Index Kit (Illumina), followed by adaptors P1 (AATGATACGGCGACCACCGA ...
-
bioRxiv - Microbiology 2021Quote: ... with HiSeq Rapid SBS kit v2 (Illumina), generating paired-end reads up to 250 bp ...
-
bioRxiv - Genetics 2019Quote: ... and Index Kit (Illumina FC-131-1001), according to the standard manufacturer protocol ...
-
bioRxiv - Genomics 2021Quote: ... purified for library preparation (Illumina Library Kit), and deep-sequencing with 200 million tags through Illumina HiSeq2500 sequencer.
-
bioRxiv - Genomics 2021Quote: ... rRNA was depleted using RiboZero kit (Illumina). NGS-libraries were generated using NEBnext Ultra II directional RNA library prep kit for Illumina and sequenced as PE75 reads on an Illumina NextSeq550.
-
bioRxiv - Genomics 2021Quote: KAPA Hyper Prep Kits from Illumina (KK8500) were used to construct the library with a slight modification to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... using the TruSeq SBS Kit v3 (Illumina). An average of 40 million paired reads were generated per sample ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2.5μl Transposase enzyme (Illumina Nextera kit, 15028252) and 22.5μl Nuclease-free water in a total of 50uL reaction for 1 hour at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... TruSeq Stranded mRNA Library Prep kit (Illumina) was used to assess transcript abundance following standard instructions from the manufacturer ...
-
bioRxiv - Neuroscience 2022Quote: ... the TruSeq stranded RNA kit (Illumina Inc.) was used according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... The Kapa Hyper Prep kit (for Illumina) was used for sequencing library preparation ...
-
bioRxiv - Microbiology 2022Quote: ... Multiplexing Sample Preparation Oligonucleotide Kit from Illumina, Inc ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and Nextera XT index kit D (Illumina). Amplicon sizes were verified on a Tapestation using the High Sensitivity D1000 Screentape (Agilent) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Ribo-Zero rRNA removal kit (Illumina). After purifying RNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... tagmentation (Nextera DNA Sample Preparation Kit, Illumina) and library preparation was performed ...
-
bioRxiv - Neuroscience 2022Quote: ... The TruSeq RNA Sample Prep Kit (Illumina) was used for library preparation from all samples ...
-
bioRxiv - Microbiology 2023Quote: ... using TruSeq SBS Kit v3 - HS (Illumina) for 50 cycles ...
-
bioRxiv - Genomics 2023Quote: The Nextera XT Index Kit (Illumina inc.) was used to construct the libraries ...
-
bioRxiv - Microbiology 2023Quote: ... using a MiSeq Reagent kit v3 (Illumina) following the standard guidelines for preparing and loading samples on the MiSeq ...
-
bioRxiv - Neuroscience 2023Quote: ... and purified with a RiboZero kit (Illumina). The resulting mRNA fragment inserts were then reverse transcribed to first strand cDNA using reverse transcriptase and random primer in the presence of actinomycin D ...
-
bioRxiv - Immunology 2023Quote: ... and Nextera XT library prep kit (Illumina) with an input of 10ng of RNA per sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... TruSeq RNA Library Prep Kit v2 (Illumina) was used to prepare a whole-transcriptome sequencing library and sequenced on one lane of a NovaSeq 6000 SP (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... the TruSeq stranded mRNA kit protocol (Illumina) was followed to make libraries ...
-
bioRxiv - Immunology 2023Quote: ... using a NextSeq P3 sequencing kit (Illumina) with a target depth of 5 million reads per sample ...
-
bioRxiv - Microbiology 2023Quote: ... A TruSeq DNA Library Preparation Kit (Illumina) was used for cDNA library preparation ...
-
bioRxiv - Molecular Biology 2023Quote: ... The NexteraXT DNA Library Preparation Kit (Illumina) was used to generate sequencing libraries (1/5th of the recommended volume) ...
-
bioRxiv - Microbiology 2023Quote: ... the Illumina TruSeq Stranded mRNA kit (Illumina) was used to build the null mutant and IP libraries ...
-
bioRxiv - Genetics 2023Quote: ... the TruSeq DNA Methylation Kit (Illumina Inc.) was used ...
-
bioRxiv - Cancer Biology 2023Quote: ... using TruSeq ChIP Sample Preparation Kit (Illumina) or ThruPLEX® DNA-seq Kit (Rubicon Genomics ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Illumina Nextera kit (Illumina, San Diego, CA) was used for library preparation and the samples were sequenced with NextSeq 550 platform ...
-
bioRxiv - Genomics 2023Quote: The Nextera XT Index Kit (Illumina Inc.) was used for the first amplicon generation followed by NGS library preparation of the QC passed samples ...
-
bioRxiv - Genomics 2023Quote: ... the TruSeq Ribo Profile (Mammalian) Kit (Illumina) was used in accordance with the manufacturer’s specifications ...
-
bioRxiv - Cancer Biology 2023Quote: ... libraries were prepared using TruSeq Kit (Illumina). RNA-sequencing (30 million reads per sample ...
-
bioRxiv - Bioengineering 2023Quote: ... Illumina TruSeq RNA stranded kit (Illumina, US) was used for library preparation ...
-
bioRxiv - Cancer Biology 2022Quote: The TruSight Oncology 500 Kit (TSO500, Illumina) was used for DNA library preparation and enrichment following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... Libraries were barcoded (Nextera Index Kit, Illumina) and amplified with NEBNext High Fidelity PCR Mix (New England Biolabs) ...
-
bioRxiv - Microbiology 2023Quote: ... using the MiSeq Reagent Kit v3 (Illumina) and paired-end 300bp chemistry ...
-
bioRxiv - Immunology 2023Quote: ... using the TruSeq SBS Kit v4 (Illumina). An average of 42 million paired reads were generated per sample and the percent of mRNA bases per sample ranged from 73% to 84%.
-
bioRxiv - Immunology 2023Quote: ... or HiSeq 3000/4000 SBS Kit (Illumina). An average of 100 million paired reads were generated per sample.
-
bioRxiv - Microbiology 2023Quote: ... the TruSeq Stranded Library Preparation kit (Illumina) was used to prepare the sequencing library ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The Nextera XT Sample Prep kit (Illumina) and Nextera XT Index kit v2 (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human Ribo-Zero rRNA depletion kit (Illumina). Paired-end 150+150 bp sequencing was performed at the Institute for Molecular Medicine Finland FIMM Genomics unit with Illumina NovaSeq 6000 using partial S4 flow cell lane ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ligation Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... a P2 reagent kit (100 cycles) (Illumina) was used for NGS.