Labshake search
Citations for Illumina :
351 - 400 of 1190 citations for Human PDGF alpha receptor PDGFRA qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... Libraries were pooled at equal molar concentration and sequenced paired-end on an Illumina HiSeq 2500 or NovaSeq 6000 sequencing system to a minimum depth of 15 million reads with each a length of 100 base pairs (S4 flowcell 200 cycle v1.0, Xp workflow; Illumina).
-
bioRxiv - Genomics 2024Quote: ... Each sample was sequenced to a target depth of 37.5 million read pairs using a NovaSeq 6000 device (Illumina).
-
bioRxiv - Evolutionary Biology 2024Quote: ... on an Illumina NovaSeq 6000 with an expectation of a minimum number of 1.5 million read pairs per sample. We used Stacks v.2.62 (Catchen et al. 2011, 2013) to build loci from Illumina reads ...
-
bioRxiv - Systems Biology 2024Quote: ... The resulting cDNAs were subjected to 150 base pair (bp) paired-end sequencing on an Illumina NovaSeq6000 Platform (Illumina). Sequences were aligned to the reference genome of mice derived from the Ensembl database86,87 (GRCm38/mm10 ...
-
bioRxiv - Genomics 2024Quote: ... Libraries showing successful transposition were sequenced to a target depth of 112.5 million read pairs using a NovaSeq 6000 device (Illumina).
-
bioRxiv - Genetics 2023Quote: ... in a 100 µl reaction with 2 µl gDNA (∼100 ng) and primers oJMP697 and oJMP698 (nested primers with partial adapters for index PCR with Illumina TruSeq adapter) according to the manufacturer’s protocol using a BioRad C1000 thermal cycler with the following program ...
-
bioRxiv - Systems Biology 2023Quote: ... in a 100 µl reaction with 2 µl gDNA (∼100 ng) and primers oJMP697 and oJMP698 (nested primers with adapters for index PCR with Illumina TruSeq adapter) according to the manufacturer’s protocol using a BioRad C1000 thermocycler with the following program ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Extracted DNA was PCR amplified with a forward primer binding to the end of the leader sequence (PCR1 Fwd primer with Illumina adapter overhang) and a reverse primer annealing to the intronic region directly 3’ of the J segment (PCR1 Rev primer with Illumina adapter overhang) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and a reverse primer annealing to the intronic region directly 3’ of the J segment (PCR1 Rev primer with Illumina adapter overhang). PCRs were performed with Q5 High-fidelity DNA polymerase (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... in a 100 µl reaction with 2 µl gDNA (∼100 ng) and primers oJMP697 and oJMP698 (nested primers with adapters for index PCR with Illumina TruSeq adapter) according to the manufacturer’s protocol using a BioRad C1000 thermalcycler with the following program ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 sets of class-specific IGH and lGK/L constant region gene-specific reverse primers (with second-round primers including Illumina Read2 sequence). Primer sequences are listed in Supplementary table S7 ...
-
bioRxiv - Genomics 2020Quote: ... and using custom sequencing primers and recipe from Illumina.
-
bioRxiv - Genetics 2020Quote: ... The first PCR used universal primers (without Illumina indexes) to amplify the barcodes ...
-
bioRxiv - Cancer Biology 2020Quote: ... and i7 Index Primer (Nextera XT Index Kit, Illumina). Unique i7 Indexes were used for each ICELL8® 3’ DE Chip ...
-
bioRxiv - Microbiology 2021Quote: ... 0.1 µM each primer (Primer1 and Primer2 for Illumina), 0.3 mM dNTP ...
-
bioRxiv - Molecular Biology 2020Quote: ... by PCR amplification using Illumina sequencing adaptor primers (Illumina). Paired-end sequencing was performed on a Hi-Seq 2500 System (University of Georgia Genomics Core ...
-
bioRxiv - Immunology 2021Quote: ... Nextera i5 and i7 dual-index library primers (Illumina), and the following PCR settings ...
-
bioRxiv - Genomics 2021Quote: ... and 1.5 ul reverse primer (Illumina TruSeq Read 1), 4 ul cDNA ...
-
bioRxiv - Genomics 2021Quote: ... 1 μL 12.5 μM Nextera Ad2 barcoded primer (Illumina), 23 μL water) ...
-
bioRxiv - Developmental Biology 2020Quote: ... initially with primers containing the adaptors (Universal adaptors; Illumina) and subsequently another 8-12 PCR cycles with the specific primers (Illumina Nextera XT index kit) ...
-
bioRxiv - Genomics 2020Quote: ... using the 96-well plate Nextera indexing primers (Illumina), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... ATAC-seq libraries were amplified with Nextera primers (Illumina) by PCR and purified with AMPure beads (Beckman Coulter) ...
-
bioRxiv - Neuroscience 2022Quote: ... The primers used for indexing were obtained from Illumina, and the libraries were quantified and QC was done using the KAPA Library Quantification Kit ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primer indices were used in the reaction from Illumina (Nextera index primers i7 and i5 ...
-
bioRxiv - Microbiology 2023Quote: ... Primers were bar-coded using TruSeq Index Adapters (Illumina), allowing the mixing of samples from different individuals when sequencing PCR products using NextSeq sequencers (Illumina) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Dual index primer-Multiplex Oligos (Cat# E7600S, Illumina).
-
bioRxiv - Genetics 2023Quote: ... using PCR primers ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCAGAAGCAGCTCGACGC and GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCAGCTGCCGGAAGTGCT (Illumina adapters underlined) and Phire DNA polymerase (Thermofisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse and forward amplicon PCR primers recommended by Illumina were used (16s Amplicon PCR Forward Primer= TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 µM RT Primer (RTP, TruSeq kit; Illumina) was then performed according to the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2023Quote: ... and Index primer i5 (Illumina, FC-131-2001/2002) was combined with 12.5μl of the tagmented amplicon DNA ...
-
bioRxiv - Immunology 2024Quote: ... with dual indexing primers (Illumina, Cat#FC-131-2004) to generate a sequencing library ...
-
bioRxiv - Physiology 2024Quote: ... The adaptors and sequencing primers were obtained from Illumina. The libraries were sequenced by Novogene using the NovaSeq 6000 (PE150 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 µL of 10 µM RPI-X primer (Illumina), 1 µL of 10 µM P5-TSO primer ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR reactions were performed using the Thunderbird® SYBR qPCR mix (TOYOBO) and Eco Real-Time PCR System (Illumina). The PCR primers used are listed in Supplementary Table S8 ...
-
bioRxiv - Genomics 2024Quote: ... 11 μL Nuclease-free water and 2 μL RP1 and RPIx primers each (10 mM, for details see Illumina smallRNA indexing primer sequences) to the 10 μL single-stranded DNA product ...
-
bioRxiv - Cancer Biology 2021Quote: ... The captured libraries were sequenced to achieve a mean unique coverage of at least 1000x using Illumina v.4 chemistry and paired-end 100-base pair (bp) reads (HiSeq, Illumina).
-
bioRxiv - Evolutionary Biology 2020Quote: ... in the pair-end mode using HiSeq Rapid Pair-end Cluster Kit v2 and HiSeq Rapid SBS Kit v2 500 cycle kit (Illumina) reagents ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were single end (75bp) or pair-end sequenced at 36 bp by 36 bp on a Nextseq550 flow cell (Illumina).
-
bioRxiv - Cell Biology 2021Quote: ... The remaining RNA fragments were used to construct a strand-specific cDNA library using the dUTP method (average library insert size was 300 ± 50 bp) and pair-end sequencing was performed using the Hiseq 4000 (Illumina) following the manufacturer’s recommended protocol ...
-
bioRxiv - Systems Biology 2020Quote: ... Equal amounts of each library were combined and sent to the Genomic Analysis Platform (IBIS, Quebec, Canada) for pair-end 300bp sequencing on a MiSeq (Illumina).
-
bioRxiv - Neuroscience 2020Quote: ... The pooled exome libraries were distributed across four lanes on an S4 flow cell and sequenced using 150 base pair paired-end approach on a NovaSeq 6000 instrument (Illumina). All sequencing was performed on the Illumina NovaSeq 6000 platform by loading a pool samples to the equivalent loading of 24 samples per flowcell ...
-
bioRxiv - Cell Biology 2021Quote: ... and sequenced using the pair-end 76bp protocol at about 520 million reads per library using the NovaSeq platform (Illumina) per the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR amplicons were generated from the plasmids using primer pairs oKAC1589/oKAC1590 (for the catalytic domain) or oKAC1591/oKAC1592 (for the PI domain) and sequenced on a MiSeq (Illumina) to a depth of 12,378 and 409,221 reads for the catalytic and PI domain libraries ...
-
bioRxiv - Immunology 2020Quote: ... The final product was quantified by Bioanalyzer Agilent DNA 1000 and pooled together in equal molar ratio and pair-end sequenced by using MiSeq (Illumina) with MiSeq Reagent Kit V3 150-cycle (Illumina).
-
bioRxiv - Immunology 2022Quote: ... whose lengths were about 600 base pairs were sequenced using an Illumina Novaseq 6000 S4 flowcell (67 bp read 1 and 140 bp read 2) (Illumina). Only read2 contained the sequence regarding the definition of T cell clones.
-
bioRxiv - Immunology 2020Quote: ... Libraries were then pooled at equal molar concentration (Fig. S5) and sequenced on an Illumina NextSeq 500 sequencer to obtain a total of 941M read pairs (Illumina). An average of 78M read pairs per sample were generated with a standard deviation of 10.7M read pairs ...
-
bioRxiv - Genomics 2020Quote: ... At least 4 μg of genomic DNA from each accession was used to construct pair-end sequencing libraries with insert sizes of approximately 300-bp or 500-bp following the manufacturer’s instructions (Illumina Inc.) (Supplemental Table 1) ...
-
bioRxiv - Immunology 2020Quote: ... RNA libraries were then prepared from two biological replicates per condition and samples were sequenced using 75 base pair single-end reading on HiSeq 2500 high-output instrument (Illumina). The raw reads were then subjected to trimming by Trim Galore (https://github.com/FelixKrueger/TrimGalore ...
-
bioRxiv - Immunology 2020Quote: ... and sequenced across 75 base pairs (bp) using a paired-end strategy with a 150-cycle high-output flow cell on a NextSeq 550 (Illumina). Three biological replicates were sequenced per experiment ...
-
bioRxiv - Genetics 2021Quote: ... pooled and subjected to cluster and pair-read sequencing was performed for 150 cycles on a HiSeqX10 instrument (Illumina, USA), according to the manufacturer’s instructions.