Labshake search
Citations for Illumina :
351 - 400 of 512 citations for 6 Chloro 4 iodo 3 pyridinol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... 4.5 µl of sample were used to generate single cell RNA-Seq libraries by following the Illumina Bio-Rad SureCell WTA 3’ Library Prep Guide (Illumina, San Diego CA and Bio-Rad ...
-
bioRxiv - Genomics 2024Quote: ... was used for a tagmentation reaction that included 3 µL of 2X TMP buffer and 0.5 µL of Transposome (BLT; CAT # 20015880, Illumina Inc.), incubated in a thermocycler at 53 ℃ for 30 minutes with the lid set at 80 ℃ ...
-
bioRxiv - Microbiology 2023Quote: Amplification of the V4 region of the 16S rRNA gene was carried out in triplicates with primers containing illumina adapters (515F-Illumina 5’-TCG TCG GCA GCG TCA GAT GTG TAT AAG AGA CAG GTG CCA GCM GCC GCG GTA A-3’ and 806R-Illumina 5’-GTC TCG TGG GCT CGG AGA TGT GTA TAA GAG ACA GGG ACT ACH VGG GTW TCT AAT-3’) ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA-seq libraries for yeast (n = 3 per tested condition) and neuroblastoma cells (n = 3 per tested condition) were prepared according to the TruSeq stranded mRNA protocol (Illumina) and 101-bp single-end reads produced on an Illumina NovaSeq 6000 instrument ...
-
bioRxiv - Cancer Biology 2023Quote: ... with library preparation using the Chromium Next GEM Single Cell 3’ Kit (10x Genomics, PN-1000268) and sequencing was performed on the NovaSeq 6000 (Illumina) by the WSU GSC ...
-
bioRxiv - Cancer Biology 2023Quote: ... Spatially tagged cDNA libraries were constructed with the 10x Genomics Visium Spatial Gene Expression 3’ Library Construction V1 Kit and then sequenced on Novaseq (Illumina)
-
bioRxiv - Genomics 2022Quote: ... Individual libraries were then combined in 3-plex reactions for probe hybridization using oligos from the respiratory panel (Cat No: 20044311, Illumina). The Respiratory Virus Oligo Panel (RVOP ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was prepared using the manufacturers protocol (Chromium Single Cell 3’ reagent kits kit v3, 10x Genomics) and sequenced on a Novaseq 6000 instrument (Illumina). After sample processing and quality control analysis ...
-
bioRxiv - Cell Biology 2023Quote: ... Illumina sequencing libraries were indexed with unique 5’ and 3’ barcode combinations (up to 384 cells) using the Nextera XT DNA library preparation kit (Illumina). Libraries were pooled and size-selected with 0.9X AmpPure XP beads ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA libraries were prepared using the 10X Genomics 3’mRNA-seq workflow (10X Genomics) and sequenced using a NovaSeq instrument (Illumina). Data was processed using CellRanger (10X Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were processed using the Chromium Next GEM Single Cell 3’ Reagent Kits (10x genomics) and sequenced on a NovaSeq 6000 (Illumina) at the Harvard Medical School Biopolymers Core Facility as 28 (read 1 ...
-
bioRxiv - Microbiology 2023Quote: ... 3-5 µg of each sample was treated with Ribozero® rRNA Removal Kit according to the manufacturer’s instructions (Illumina, USA ...
-
bioRxiv - Microbiology 2023Quote: ... The transposon-specific primer was designed to include (from 5’ to 3’): (i) the “P5” or “P7” flow-cell annealing sequence (Illumina), (ii ...
-
bioRxiv - Genomics 2023Quote: ... Micro-C libraries (at least 3 per each biological replicate) that passed QC criteria were pooled and paired-end sequenced on a NovaSeq6000 platform (Illumina) to >600 million read pairs per replicate ...
-
bioRxiv - Immunology 2023Quote: ... ADT and 3’ Gexp libraries were mixed at the ratio of 1:5 and sequenced on NovaSeq 6000 sequencer (Illumina) with a configuration of 28/8/0/91-bp for cell barcode ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 3) DNA Sequencing and Genomics Laboratory (BIDGEN): Libraries were prepared using the Nextera™ DNA Flex Library Preparation Kit (Illumina) and sequenced on a NovaSeq6000 to generate 2 x 150 bp reads ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA was dephosphorylated in 3’ and then phosphorylated in 5’ to generate cDNA libraries using the NebNext Small RNA Sample Prep kit with 3’ sRNA Adapter (Illumina) according to the manufacturer’s protocol with 12 cycles of PCR amplification in the last step followed by DNA purification with Monarch PCR DNA cleanup kit (NEB) ...
-
bioRxiv - Neuroscience 2024Quote: ... Single nuclei were isolated from frozen brain tissue using iodixanol-based density gradient centrifugation and submitted to UCLA Technology Center for Genomics and Bioinformatics for library preparation (via Chromium Single Cell 3’ v3 kit from 10x Genomics) and sequencing (via NovaSeq 6000 S2 platform from Illumina). Cell Ranger (10x Genomics ...
-
bioRxiv - Genomics 2024Quote: All samples were processed using the 10x Genomics Chromium 3’ Single Cell Protocol and sequenced using NovaSeq 6000 S1 (Illumina). For the first sample containing NSC pools 1.1 and 1.2 ...
-
bioRxiv - Immunology 2024Quote: Bulk RNA-Seq: Libraries were generated using a QuantSeq 3’ mRNA-Seq Library Prep Kit (Lexogen) and sequenced using a NovaSeq (Illumina). After adaptor trimming ...
-
bioRxiv - Cell Biology 2024Quote: ... The library preparation and RNA sequencing was performed by Birmingham Genomic centre using Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD from Illumina. Libraries were quantified using a PicoGreen Quant-iT kit and sized with a D1000 tape ...
-
bioRxiv - Immunology 2024Quote: ... Single-cell RNA libraries were prepared according to the 10x Genomics Chromium Single Cell 3′ Reagent Kits v2 User Guide and sequenced (paired-end) on a HiSeq 4000 (Illumina).
-
bioRxiv - Immunology 2021Quote: ... GEX libraries were pooled and sequenced at a depth of approximately 540,000,000 reads per sample in a single S4 flow cell and ADT libraries at a depth of approximately 79,000,000 reads per sample in a single lane of an S4 flow cell on a NovaSeq™ 6000 (Illumina, San Diego, CA; Extended Data Table 6)
-
bioRxiv - Evolutionary Biology 2021Quote: ... Amplicons were calculated for their nano-molarity and diluted to 4 nM (see Illumina 470-2016-007-B) for HTS run on MiSeq sequencer using the Illumina MiSeq Reagent Kit Version 3 (600bp pair-ended) ...
-
bioRxiv - Molecular Biology 2021Quote: ... before being diluted to approximately 4 nM for loading onto an Illumina MiSeq (Illumina, San Diego, CA, USA). An Illumina 500 cycle MiSeq Reagent Kit v2 (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... and 4 samples were combined into RNA-seq runs on the Illumina MiSeq platform (Illumina, San Diego, CA).
-
bioRxiv - Genomics 2021Quote: ... The final libraries at the concentration of 4 nM were sequenced on NextSeq 500 platform (Illumina, CA, USA) using 75 bp paired-end sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μg total RNA per sample were used for the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina) to generate cDNA libraries according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... The additional 71 ASH donors were genotyped separately at 4,327,108 SNPs with the Infinium Omni5-4 v1.2 BeadChip (Illumina, California). We updated SNP identifiers based on Illumina annotation files (https://support.illumina.com/content/dam/illumina-support/documents/downloads/productfiles/humanomni5-4/v1-2/infinium-omni5-4-v1-2-a1-b144-rsids.zip ...
-
bioRxiv - Immunology 2022Quote: ... High-resolution 4-digit HLA typing was performed with the TruSight HLA v2 Sequencing Panel kit from Illumina according to the manufacturer instruction ...
-
bioRxiv - Microbiology 2022Quote: ... Six samples per condition containing 4 μg of total RNA were used for TruSeq mRNA library preparation (Illumina) after being treated with Globin-Zero Gold rRNA Removal Kit (Illumina) ...
-
bioRxiv - Systems Biology 2023Quote: ... 200-500 ng DNA was used for genotyping using the Infinium Omni2.5-8v1-4 and the Infinium Omni2.5-8v1-5 Genotyping BeadChip (Illumina) at the UCSD IGM core ...
-
bioRxiv - Genomics 2023Quote: ... indexed using IDT for Illumina Nextera UD indexes Sets 1–4 (384 Indexes, Cat no: 20043137, Illumina, USA) and products were amplified ...
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were pooled together and sequenced using 75bp paired-end chemistry across 4 lanes of a Hiseq4000instrument (Illumina) to achieve 10 million reads per sample ...
-
bioRxiv - Cell Biology 2020Quote: ... an oligonucleotide containing the Illumina P7 adaptor sequence was ligated to the 3’ end of the single stranded LAM PCR fragments using Circligase (Epicentre/Illumina, #CL9025K). A P5 adaptor was added by PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... Sequencing libraries (1.3 nM) were chemically denatured and applied to an Illumina NovaSeq flow cell using the NovaSeq XP chemistry workflow (Illumina-20021664). Following transfer of the flowcell to an Illumina NovaSeq instrument ...
-
bioRxiv - Neuroscience 2020Quote: ... The cell solutions were immediately transferred to ice and transported to the Wellcome Trust Centre for Human Genetics (WTCHG) for scRNAseq via 10x genomics chromium (10x genomics, US) (Single Cell 3’ v3) and Illumina hiseq 4000 (Illumina, US). This approach achieved 66-72K mean reads per cell and a sequencing depth of 53-55% per cell before filtering.
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was extracted and sequence reads (100 bp paired-end) were generated with Illumina TruSeq high output version 3 chemistry on a HiSeq 2500 (Illumina, Inc.) at NRC-Plant Biotechnology Institute (NRC-PBI) ...
-
bioRxiv - Cancer Biology 2020Quote: ... TN5 tagmentation and library amplification realized 3’end fragments by Nextera XT DNA Sample Preparation Kit (Illumina, Cat#FC-131-1024) according to the manufacturer’s instructions while P5_TSO and Nextera_N7xx took the place of the custom primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... 500 ng of total RNA were used as input for QuantSeq (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina; Lexogen) following the autoQuantSeq automated workflow ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) were sequenced using the Illumina MiSeq 2 × 300 bp platform with MiSeq Reagent Kit v3 (Illumina Co.) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... CC (third part, forward primer linker) AGMGTTYGATYMTGGCTCAG (fourth part, forward primer) and 338R CAAGCAGAAGACGGCATACGAGAT (first part, reverse complement of 3′ Illumina adaptor) ACGAGACTGATT (second part ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were processed according to the standard 10x Chromium 3’ workflow and pooled before sequencing over two lanes (Illumina HiSeq 4000).
-
bioRxiv - Genomics 2019Quote: ... The resulting libraries always contain dual-indexes in the standard indexing positions and may optionally contain additional internal indexes (Figs. 1–3; Table 1; Illumina, 2018b). These indexes are recovered through the four standard separate sequencing reactions generated by Illumina instruments when doing paired-end sequencing (Fig ...
-
bioRxiv - Cancer Biology 2019Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters from TruSeq™ Stranded Total RNA Sample Preparation Kit with Ribo-Zero Gold (Illumina) were ligated.
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng alkylated RNA was used and prepared with a commercially available kit (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina, Lexogen). Sequencing was performed on an Illumina NovaSeq SP platform in 100bp-single-read mode.
-
bioRxiv - Genomics 2021Quote: ... and 1µM Dexamethasone or 0.1% ethanol for 3 hours. Transposition was performed using the OmniATAC protocol (Corces et al. 2017) and the tagment DNA TDE1 enzyme (Illumina, 20034197). DNA was purified using the MinElute PCR purification kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: The input samples were submitted to the Washington University Genome Technology Access Center to obtain and sequence the cDNA libraries (10XGenomics, 3’v3.1; Illumina NovaSeq S4) according to established protocols ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl of PCR 1 were used as template for PCR 2 (14 cycles) and used forward primers 5’-AATGATACGGCGACCACCGAGATCTACAC-NNNNNNNN-ACACTCTTTCCCTACACGAC-3’ (compatible to Illumina i5) and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7) ...
-
bioRxiv - Immunology 2024Quote: ... 2024) using the command CreateSeuratObject with the following parameters: min.cells = 3 and either min.features = 200 (for Illumina reads from MBC gate) or min.features = 100 (for the Oxford Nanopore reads from the ASC gate) ...