Labshake search
Citations for Illumina :
351 - 400 of 1884 citations for 2' 5' Dichloro 3 3 4 dimethylphenyl propiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2021Quote: ... Libraries were then pooled in groups of 4 and sequenced on 4 lanes on a NextSeq500 sequencer (Illumina) using 10X Genomics recommended reads configuration.
-
bioRxiv - Genetics 2022Quote: ... The flow cell was loaded with 5 picomolar pooled libraries containing 5% PhiX control V3 (Illumina). Raw sequencing data were demultiplexed with Bcl2Fastq software (v2.19 ...
-
bioRxiv - Microbiology 2024Quote: ... with 5% PhiX loading control (Illumina).
-
bioRxiv - Genomics 2024Quote: ... with 5% PhiX spike-in (Illumina).
-
bioRxiv - Cancer Biology 2024Quote: ... with 5% PhiX library control (Illumina). Autosmal ranged from 23X to 29X ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... High-throughput genome sequencing was performed either on Hiseq 2000 (2 × 100 or 2 × 150 paired-end reads) or Miseq (2 × 300 paired-end reads) sequencer (Illumina, San Diego, CA) following the manufacturer ‘s instruction.
-
bioRxiv - Physiology 2021Quote: ... High-throughput genome sequencing was performed on a HiSeq 2500 (2 × 100 or 2 × 150 paired-end reads) or MiSeq (2 × 300 paired-end reads) sequencer (Illumina, San Diego, CA), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Each well contained 10 μL tagmentation buffer (5 μL NIB and 5 μL TD buffer from Illumina). For the second sort plate ...
-
bioRxiv - Genomics 2024Quote: ... The 33 samples were combined into 2 pools and sequenced using 2 NovaSeq (Illumina) S4 200 cycle flow cells.
-
bioRxiv - Cell Biology 2020Quote: ... and D (v.2, Illumina) and sequenced on HiSeq4000 and NovaSeq6000 (Illumina ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μl Tn5 enzyme (Illumina), 0.25 μl 1 % digitonin ...
-
bioRxiv - Genetics 2023Quote: 2×150bp reads from Illumina NovaSeq were obtained for all samples with a minimum depth of 22M reads at Novogene (Beijing ...
-
bioRxiv - Genetics 2023Quote: 2×150bp reads from Illumina NovaSeq were obtained for all samples with a minimum depth of 17 M reads at Novogene (Beijing ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2) Detection from Illumina RNA-seq data through SL leader sequence trimming(43) ...
-
bioRxiv - Microbiology 2021Quote: ... UK). Libraries were prepared from 8 samples (4× T. brucei, 4× T. congolense) using the TruSeq Stranded mRNA kit (Illumina) and 2 × 75 bp paired-end sequencing was carried out using a HiSeq 4000 system (Illumina) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Barcoded libraries of ten samples (4 treated, 4 untreated and two controls) were equimolarly pooled and sequenced on MiSeq (Illumina) using MiSeq v3 150 reagent kit (MS-102-3001 ...
-
bioRxiv - Genomics 2023Quote: ... coverage and eight additional female genomes (4 Asian and 4 African) at ~30× (1 lane of Illumina Hiseq X Ten) coverage using 10x Linked-Reads at HudsonAlpha Institute of Biotechnology ...
-
bioRxiv - Genomics 2023Quote: ... 4 washes with PR2 buffer (PR2, Illumina MiSeq), and 6 minute incubation at 60°C with shaking followed by 4 washes was performed a total of 3 times ...
-
bioRxiv - Biophysics 2021Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl Nextera i5 primer (S5xx, Illumina), and 5 μl of a custom i7 primer mix (0.5 μM i7_BCx + 10 μM i7_primer ...
-
bioRxiv - Biophysics 2023Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples (GJJ_1J) ...
-
bioRxiv - Biophysics 2022Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Biochemistry 2024Quote: ... with 5% phiX (Illumina, FC-110-3001) was loaded to the sequencer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 × 150 bp flow cells (Illumina).
-
bioRxiv - Neuroscience 2023Quote: ... and sequencing (Illumina HiSeq 2 × 150bp) were all performed at GeneWiz ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2% PhiX (PhiX Control v3, Illumina) was spiked into the sample and 20 µL were added to an Illumina iSeq 100 i1 Reagent v2 cartridge ...
-
bioRxiv - Biochemistry 2024Quote: ... Round 2 primers (Illumina TruSeq Adapters) were added to each reaction to 400 nM ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2×150 cycle strategy (Illumina Inc.). Paired-end reads were produced with a 100x coverage ...
-
bioRxiv - Immunology 2022Quote: ... or NovaSeq XP 4-Lane Kit v1.5 (Illumina, 20043131).
-
bioRxiv - Immunology 2022Quote: ... or NovaSeq XP 4-Lane Kit v1.5 (Illumina, 20043131).
-
bioRxiv - Immunology 2022Quote: ... or NovaSeq XP 4-Lane Kit v1.5 (Illumina, 20043131).
-
bioRxiv - Genomics 2023Quote: ... The resulting sequencing libraries were sequenced using the MiSeq system (Illumina v.2 kit, 2 × 150 bp).
-
bioRxiv - Microbiology 2021Quote: ... with 5% (v/v) 20 pM PhiX (Illumina), using 150 cycle v3 cartridges ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2023Quote: ... In each sequencing run 5% of PhiX (Illumina) was included as an internal control ...
-
bioRxiv - Cell Biology 2024Quote: ... spiked in with 5% PhiX Control v3 (Illumina) and sequenced on an Illumina Novaseq 6000 at a depth of ∼50,000 reads/cell with dual index ...
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Physiology 2024Quote: ... sequencing was performed on a NextSeq instrument (2×75bp 2×10) according to the manufacturer instructions (Illumina Inc.) Reads were trimmed and ribosomal RNA reads were removed ...
-
bioRxiv - Cancer Biology 2020Quote: ... and loaded at 4 nM into the MiSeq sequencer (Illumina) v3 chemistry kit spiked with 10% PhiX genome ...
-
bioRxiv - Immunology 2023Quote: ... or the NovaSeq XP 4-Lane Kit v1.5 (Illumina, 20043131).
-
bioRxiv - Systems Biology 2021Quote: ... S4 reagent cartridge (2×100 bp) (Illumina).
-
bioRxiv - Neuroscience 2020Quote: ... ADNI GO/2 participants (Illumina HumanOmniExpress BeadChip), and ADNI3 participants (Illumina Omni 2.5M ...
-
bioRxiv - Microbiology 2020Quote: ... and sequencing (2 × 150 bp, Illumina HiSeq) were performed by Genewiz (South Plainfield ...
-
bioRxiv - Microbiology 2022Quote: ... 2 (Illumina, catalog No. MS-102-2003) by the University of Michigan Microbial Systems Molecular Biology Laboratory as described previously (14) ...
-
bioRxiv - Microbiology 2021Quote: ... 2) merged triplicates for DC3000 + (Illumina only), 3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and sequenced on 2×150 Miseq (Illumina). Clonal abundances were estimated using a pipeline adapted from 110 ...
-
bioRxiv - Microbiology 2022Quote: ... generating 2 × 300bp paired-end reads (Illumina).
-
bioRxiv - Immunology 2023Quote: ... and HiSeq2500 V2 2×150bp (Illumina®) protocols at the “Institut du Cerveau” (ICM ...
-
bioRxiv - Molecular Biology 2023Quote: ... or SMART-Seq™ 2 (Illumina, 20040532), followed by NovaSeq (RIP-seq experiments from Figs ...