Labshake search
Citations for Illumina :
3901 - 3950 of 9151 citations for Rat Endoplasmin HSP90b1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... and sequenced on an Illumina MiSeq with a 150-cycle kit (Illumina MS-102-3001) with 75 cycles for each read and 8 cycles for each index ...
-
bioRxiv - Immunology 2024Quote: ... and tagmented using the enzyme and buffer provided in the Nextera Library Prep Kit (Illumina). Tagmented DNA was then purified using the MinElute PCR purification kit (Qiagen) ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries were generated using TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... The sequencing library was prepared using the Illumina DNA Prep Kit (Illumina, California, United States), according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... Full library preparation was performed using the TruSeq Small RNA kit (Illumina, San Diego, CA) per manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... with samples processed using MiSeq Reagent Kit V3 (150 cycles) (Illumina, Cat#MS-102-3001).
-
bioRxiv - Microbiology 2023Quote: ... and then indexed using a Nextera XT DNA Library Preparation Kit (Illumina; San Diego, CA). Finally ...
-
bioRxiv - Microbiology 2023Quote: ... The samples were prepared for sequencing using the Nextera XT DNA Library Preparation Kit (Illumina) and paired-end sequenced (2 × 300 bp ...
-
bioRxiv - Microbiology 2023Quote: ... The library was sequenced on the Illumina MiSeq using the MiSeq Reagent Kit v3 (Illumina). Deep sequencing was performed in duplicate for each sample.
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA library preparation was performed using illumina Nextera library perp kit (Illumina, FC-131-1024) with 0.6ng cDNA as input ...
-
bioRxiv - Bioengineering 2023Quote: ... the samples to be pooled were barcoded using the Nextera XT Index Kit v2 (Illumina). The final sequencing libraries were then purified using AMPure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was tagmented using Nextera XT DNA Library Preparation Kit (Illumina catalog #FC-131-1024) and libraries were amplified by PCR as per ATAC-seq libraries above.
-
bioRxiv - Genomics 2023Quote: ... Total RNA-seq was performed using the RiboZero TruSeq Stranded total RNA sequencing kit (Illumina). All RNA-seq experiments were performed in at least biological duplicate.
-
bioRxiv - Microbiology 2023Quote: ... 2.5 μl of Nextera XT index primers 1 and 2 (Nextera XT Index kit, Illumina) and 2.5 μl of templated DNA ...
-
bioRxiv - Microbiology 2022Quote: ... Stranded cDNA libraries were generated using the TruSeq Stranded Total RNA Library Prep Kit (Illumina). Prior to sequencing ...
-
bioRxiv - Systems Biology 2022Quote: ... Libraries for Illumina sequencing were prepared with the TruSeq RNA Library Prep Kit v2 (Illumina) and checked for quality using the Fragment Analyzer high-sensitivity NGS kit (AATI) ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA libraries were prepared according to manual of Truseq small RNA library prep kit (Illumina). Deep sequencing (Hiseq4000 ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries were constructed using the TruSeq Nano library kit (Illumina, Inc., San Diego, CA, USA) and shotgun sequencing was performed in four runs using an Illumina HiSeq 2500 ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA libraries were prepared using Nextera XT Library Prep Kit (Illumina, San Diego, USA) following the manufacturer’s protocol with the following modifications ...
-
bioRxiv - Microbiology 2022Quote: Short read NGS libraries were prepared using the Nextera flex DNA Library Prep Kit (Illumina), and 150 bp paired-end sequencing was performed on the NovaSeq 6000 system ...
-
bioRxiv - Genomics 2023Quote: ... nine-cycles of PCR were performed using indexed primers from a Nextera Index kit (Illumina), and amplified DNA was size-selected to a size of <500 bp using AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and quantified using qPCR (KAPA Biosystems Library Quantification Kit for Illumina platforms P/N KK4824) as previously described (Couturier et al ...
-
bioRxiv - Biophysics 2023Quote: ... using iSeq 100 i1 reagent v2 kit (300 cycle) 2 x 150 read length (Illumina). The total number of reads were 150,000-400,000 per sample ...
-
bioRxiv - Microbiology 2023Quote: ... using the TruSeq Stranded Total RNA Library Prep Gold Kit (Illumina, San Diego, CA, USA), and for sequencing on the HiSeq4000 platform (Illumina) ...
-
bioRxiv - Microbiology 2023Quote: ... and submitted final products to library preparation (NEBNext Ultra RNA Library Prep Kit for Illumina), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... RNA-seq libraries were prepared using a Nextera XT kit (Illumina, San Diego, California, USA). Further ...
-
bioRxiv - Microbiology 2023Quote: ... 16S rRNA gene sequencing was performed using the Illumina MiSeq Reagent Kit v2 by Illumina MiSeq System (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA library was prepared using TruSeq RNA Library Prep Kit v2 (Illumina, RS-122-2001). The sequencing library was quantified and verified using Qubit dsDNA High Sensitivity Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA-Seq libraries were prepared using the TruSeq Stranded mRNA Library Prep kit (Illumina, 2002059). RNA-Seq and ChIP-Seq libraries were quantified on a Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stranded libraries were prepared using a TruSeq Stranded Total RNA Library Prep Gold kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... and tagmented using the enzyme and buffer provided in the Nextera Library Prep Kit (Illumina). Tagmented DNA was purified using the MinElute PCR purification kit (Qiagen) ...
-
bioRxiv - Bioengineering 2023Quote: ... All sequencing was performed using an Illumina NextSeq 75 cycle high-output kit (Illumina 20024906) in a paired end format (38 cycles read 1 + 37 cycles read 2) ...
-
bioRxiv - Genomics 2023Quote: ... using the Illumina NextSeq 500/550 High Output Kit v2.5 (75 cycles) (Cat. #20024906, Illumina). Target depth was 5 – 10 million reads per sample.
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purified DNA was used for library preparation using the NEBNext Ultra Library prep Kit (Illumina) according to manufacturer’s instructions with the following Epicypher manufacturer’s modifications ...
-
bioRxiv - Microbiology 2023Quote: ... one nanogram of DNA was fragmented and adapter ligated using the Nextera XT kit (Illumina) and unique 8bp dual-index adapters (IDT ...
-
bioRxiv - Immunology 2023Quote: ... Libraries were prepared using an Illumina Stranded mRNA Library Prep kit (Illumina, Cat no. 20040534) with IDT for Illumina RNA Unique Dual Index adapters following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced on an Illumina MiSeq using the MiSeq Reagent kit v3 (Illumina, 600 cycles). Individual amplicon pools were extracted from the raw sequencing data using the FASTQ workflow in BaseSpace (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA-seq libraries were prepared using the Illumina TruSeq Stranded mRNA Library Prep Kit (Illumina) according to manufacturer instructions and sequenced on a HiSeq 2500 platform (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... and converted to cDNA (NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina). cDNA from each sample was amplified and barcoded in a mild stringency PCR (20 cycles of 30 seconds at 98°C ...
-
bioRxiv - Immunology 2023Quote: ... an Illumina library was prepared using a Nextera DNA Library Preparation Kit (Illumina, SanDiego, CA) according to SMARTer kit instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Next-generation sequencing libraries were prepared with a Nextera XT kit (Illumina, San Diego, CA), and libraries were sequenced on an Illumina MiSeq using 300-bp paired-end reads ...
-
Engineering TALE-linked deaminases to facilitate precision adenine base editing in mitochondrial DNAbioRxiv - Molecular Biology 2023Quote: ... RNA libraries were prepared using a TruSeq Stranded Total RNA Library Prep Gold kit (Illumina). RNA library quality was assessed using a 2200 TapeStation with a D1000 ScreenTape system (Agilent) ...
-
bioRxiv - Systems Biology 2023Quote: ... Strand-specific sequencing libraries were constructed using the TruSeq Stranded Total RNA Prep kit (Illumina). DNA sequencings were performed at the NHLBI DNA Sequencing and Genomics Core ...
-
bioRxiv - Plant Biology 2023Quote: ... Libraries were constructed by Macrogen using the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina). Libraries were sequenced on an Illumina NovaSeq6000 platform NovaSeq6000 via paired-end sequencing of 150bp reads ...
-
bioRxiv - Bioengineering 2023Quote: ... Nextera XT Index Kits (96 indexes, 384 samples) were purchased from Illumina (FC-131-1002). Axygen AxyPrep Mag PCR Clean-up Kits were purchased from Thermo Fisher Scientific (MAGPCRCL) ...
-
bioRxiv - Genetics 2023Quote: ... DNA was extracted from whole blood using MasterPure DNA Purification Kit (Biozym, Illumina Inc, USA). DNA quality and quantity estimation was done by agarose gel electrophoresis and spectrophotometry ...
-
bioRxiv - Cell Biology 2022Quote: ... Nuclei pellets resuspended in 50μl of Nextera DNA Sample Preparation Kit (Illumina FC-121-1030) for tagmentation ...
-
bioRxiv - Molecular Biology 2023Quote: We used the TruSeq small RNA library prep sequencing kit (Illumina, San Diego, CA, USA) for library preparation according to manufacturing instructions except for the changes listed below ...
-
bioRxiv - Cancer Biology 2023Quote: RNA-Seq libraries for Illumina sequencing were prepared using TruSeq stranded mRNA kit (Illumina, 20020595) according to manufacturer’s instructions for high-throughput sample workflow ...