Labshake search
Citations for Illumina :
3751 - 3800 of 8814 citations for Human Bcl2 Associated Death Promoter BAD ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: Sequencing libraries were prepared with polyA enrichment using a TruSeq Stranded mRNA Prep Kit (Illumina) and sequenced on an Illumina HiSeq 2500 or NovaSeq 6000 machine at UCL Genomics with the following specifics:
-
bioRxiv - Microbiology 2023Quote: ... We used the DNA with the Illumina DNA Prep kit (Illumina; San Diego, CA, USA) with the low-volume protocol (dx.doi.org/10.17504/protocols.io.bvv8n69w ...
-
bioRxiv - Cell Biology 2024Quote: ... Libraries were prepared using non-strand-specific Illumina TruSeq Sample Preparation Kits followed by Illumina sequencing ...
-
bioRxiv - Microbiology 2024Quote: ... DNA libraries were constructed using the Nextera XT library prep kit (Illumina, San Diego, USA) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... A library was independently prepared with 1ug of total RNA for each sample by Illumina TruSeq Stranded mRNA Sample Prep Kit (#RS-122-2101, Illumina, Inc., San Diego, CA, USA). The first step in the workflow involves purifying the poly-A containing mRNA molecules using poly-T-attached magnetic beads ...
-
bioRxiv - Genomics 2024Quote: ... The sequencing library was prepared using the TruSeq Stranded Total RNA library kit (Illumina, USA) and sequenced on a NextSeq 500 Illumina platform using a paired-end approach of 75 bp.
-
bioRxiv - Immunology 2024Quote: ... Sequencing was performed using NovaSeq 6000 SP Reagent Kit v1.5 (Illumina, San Diego, CA, USA) on an Illumina NovaSeq 6000 system.
-
bioRxiv - Cancer Biology 2024Quote: ... Constructed libraries were first pooled and hybridization and capture were performed (Illumina’s Nextera Exome Kit) using the recommended protocol from the manufacturer ...
-
Reduction of chromosomal instability and inflammation is a common aspect of adaptation to aneuploidybioRxiv - Cell Biology 2023Quote: ... Strand-specific libraries were generated using the TruSeq PolyA Stranded mRNA sample preparation kit (Illumina). In brief ...
-
bioRxiv - Developmental Biology 2024Quote: ... 200 pg of cDNA were used with the Nextera XT kit (Illumina, FC-131-1096). Library molarity and quality was assessed with the Qubit and TapeStation using a DNA High sensitivity chip (Agilent Technologies) ...
-
bioRxiv - Developmental Biology 2024Quote: ... using the Illumina NextSeq 500/550 High Output Kit v2.5 (75 cycles) (Cat. #20024906, Illumina). Library preparation and sequencing of the CTCF samples was all done in parallel with sequencing on the same lane.
-
bioRxiv - Developmental Biology 2024Quote: ... PCR reactions were performed using primers from Nextera XT Index Kit (Illumina, FC-131-1001) and NEBNext High Fidelity 2X PCR Master Mix (NEB ...
-
bioRxiv - Genetics 2024Quote: DNA methylation was assessed with the Infinium HumanMethylation450 BeadChip Kit (Illumina, San Diego, CA, USA) by the Human Genotyping facility (HugeF ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... All other samples were prepared using an DNA Flex library kit (Illumina, Hayward,CA, USA) and sequenced on an Illumina NovaSeq6000 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Libraries for sequencing were prepared with the NEBNext Ultra Directional RNA Library Prep Kit (Illumina), following poly(A ...
-
bioRxiv - Genomics 2024Quote: ... and sequenced on an Illumina MiSeq with a 150-cycle kit (Illumina MS-102-3001) with 75 cycles for each read and 8 cycles for each index ...
-
bioRxiv - Immunology 2024Quote: ... and tagmented using the enzyme and buffer provided in the Nextera Library Prep Kit (Illumina). Tagmented DNA was then purified using the MinElute PCR purification kit (Qiagen) ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries were generated using TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... The sequencing library was prepared using the Illumina DNA Prep Kit (Illumina, California, United States), according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... Full library preparation was performed using the TruSeq Small RNA kit (Illumina, San Diego, CA) per manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... with samples processed using MiSeq Reagent Kit V3 (150 cycles) (Illumina, Cat#MS-102-3001).
-
bioRxiv - Microbiology 2023Quote: ... and then indexed using a Nextera XT DNA Library Preparation Kit (Illumina; San Diego, CA). Finally ...
-
bioRxiv - Microbiology 2023Quote: ... The samples were prepared for sequencing using the Nextera XT DNA Library Preparation Kit (Illumina) and paired-end sequenced (2 × 300 bp ...
-
bioRxiv - Microbiology 2023Quote: ... The library was sequenced on the Illumina MiSeq using the MiSeq Reagent Kit v3 (Illumina). Deep sequencing was performed in duplicate for each sample.
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA library preparation was performed using illumina Nextera library perp kit (Illumina, FC-131-1024) with 0.6ng cDNA as input ...
-
bioRxiv - Bioengineering 2023Quote: ... the samples to be pooled were barcoded using the Nextera XT Index Kit v2 (Illumina). The final sequencing libraries were then purified using AMPure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was tagmented using Nextera XT DNA Library Preparation Kit (Illumina catalog #FC-131-1024) and libraries were amplified by PCR as per ATAC-seq libraries above.
-
bioRxiv - Genomics 2023Quote: ... Total RNA-seq was performed using the RiboZero TruSeq Stranded total RNA sequencing kit (Illumina). All RNA-seq experiments were performed in at least biological duplicate.
-
bioRxiv - Microbiology 2023Quote: ... 2.5 μl of Nextera XT index primers 1 and 2 (Nextera XT Index kit, Illumina) and 2.5 μl of templated DNA ...
-
bioRxiv - Microbiology 2022Quote: ... Stranded cDNA libraries were generated using the TruSeq Stranded Total RNA Library Prep Kit (Illumina). Prior to sequencing ...
-
bioRxiv - Systems Biology 2022Quote: ... Libraries for Illumina sequencing were prepared with the TruSeq RNA Library Prep Kit v2 (Illumina) and checked for quality using the Fragment Analyzer high-sensitivity NGS kit (AATI) ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries were constructed using the TruSeq Nano library kit (Illumina, Inc., San Diego, CA, USA) and shotgun sequencing was performed in four runs using an Illumina HiSeq 2500 ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA libraries were prepared using Nextera XT Library Prep Kit (Illumina, San Diego, USA) following the manufacturer’s protocol with the following modifications ...
-
bioRxiv - Microbiology 2022Quote: Short read NGS libraries were prepared using the Nextera flex DNA Library Prep Kit (Illumina), and 150 bp paired-end sequencing was performed on the NovaSeq 6000 system ...
-
bioRxiv - Genomics 2023Quote: ... nine-cycles of PCR were performed using indexed primers from a Nextera Index kit (Illumina), and amplified DNA was size-selected to a size of <500 bp using AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and quantified using qPCR (KAPA Biosystems Library Quantification Kit for Illumina platforms P/N KK4824) as previously described (Couturier et al ...
-
bioRxiv - Biophysics 2023Quote: ... using iSeq 100 i1 reagent v2 kit (300 cycle) 2 x 150 read length (Illumina). The total number of reads were 150,000-400,000 per sample ...
-
bioRxiv - Microbiology 2023Quote: ... using the TruSeq Stranded Total RNA Library Prep Gold Kit (Illumina, San Diego, CA, USA), and for sequencing on the HiSeq4000 platform (Illumina) ...
-
bioRxiv - Microbiology 2023Quote: ... and submitted final products to library preparation (NEBNext Ultra RNA Library Prep Kit for Illumina), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... RNA-seq libraries were prepared using a Nextera XT kit (Illumina, San Diego, California, USA). Further ...
-
bioRxiv - Microbiology 2023Quote: ... 16S rRNA gene sequencing was performed using the Illumina MiSeq Reagent Kit v2 by Illumina MiSeq System (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA library was prepared using TruSeq RNA Library Prep Kit v2 (Illumina, RS-122-2001). The sequencing library was quantified and verified using Qubit dsDNA High Sensitivity Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA-Seq libraries were prepared using the TruSeq Stranded mRNA Library Prep kit (Illumina, 2002059). RNA-Seq and ChIP-Seq libraries were quantified on a Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stranded libraries were prepared using a TruSeq Stranded Total RNA Library Prep Gold kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... and tagmented using the enzyme and buffer provided in the Nextera Library Prep Kit (Illumina). Tagmented DNA was purified using the MinElute PCR purification kit (Qiagen) ...
-
bioRxiv - Bioengineering 2023Quote: ... All sequencing was performed using an Illumina NextSeq 75 cycle high-output kit (Illumina 20024906) in a paired end format (38 cycles read 1 + 37 cycles read 2) ...
-
bioRxiv - Genomics 2023Quote: ... using the Illumina NextSeq 500/550 High Output Kit v2.5 (75 cycles) (Cat. #20024906, Illumina). Target depth was 5 – 10 million reads per sample.
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purified DNA was used for library preparation using the NEBNext Ultra Library prep Kit (Illumina) according to manufacturer’s instructions with the following Epicypher manufacturer’s modifications ...
-
bioRxiv - Microbiology 2023Quote: ... one nanogram of DNA was fragmented and adapter ligated using the Nextera XT kit (Illumina) and unique 8bp dual-index adapters (IDT ...