Labshake search
Citations for Illumina :
301 - 350 of 1391 citations for rno mir 125b 5p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... 2.5Lμl of 10LμM TruSeq RPIX primer (Illumina), 2.5Lμl of 10LμM TruSeq Universal Adapter primer (Illumina) ...
-
bioRxiv - Microbiology 2019Quote: ... A library was prepared by adaptor ligation with the PCR primer pairs using the TruSeq Nano DNA Library Prep Kit (Illumina, Inc., San Diego, CA, USA). When two or more bands were detected using 1.5%-agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2021Quote: ... A library was prepared by adaptor ligation with the PCR primer pairs using the TruSeq Nano DNA Library Prep Kit (Illumina, Inc., San Diego, CA, USA). When two or more bands were detected using 1.5%-agarose gel electrophoresis ...
-
bioRxiv - Cell Biology 2022Quote: ... Tagmentation products were amplified by PCR by adding 1.25 µl of each N and S primers (Illumina Nextera XT 96-index kit FC-131- 1002) and 3.75 µl of NPM solution and using the following thermocycler settings ...
-
bioRxiv - Microbiology 2024Quote: ... and controls (n=30) were amplified using PCR with the F515 and R806 primer pair and sequenced using Illumina MiSeq platform (Illumina Inc., San Diego, CA, USA) (82) ...
-
bioRxiv - Genetics 2019Quote: ... in the MinION data (but not in the Illumina data set). The scaffolds matching the bacterium were removed from the analysis.
-
bioRxiv - Neuroscience 2020Quote: ... Sample indexing was performed using index sets A and D (Illumina). At this point ...
-
bioRxiv - Genomics 2020Quote: ... where one set of replicates was prepared and sequenced by Illumina on a NovaSeq 6000 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and IDT Illumina RNA UD Indexes Set B (Illumina, Cat. 20040554). Libraries were sequenced on the NovaSeq at a depth of at least 25 million reads per sample in Paired End 100 mode ...
-
bioRxiv - Molecular Biology 2022Quote: ... and IDT Illumina RNA UD Indexes Set B (Illumina, Cat. 20040554). Libraries were sequenced on the NovasSeq at a depth of at least 50 million reads per sample in Paired End 100 mode ...
-
bioRxiv - Genomics 2020Quote: ... we used VCF-formatted NA12878 truth-set small variants from Illumina Platinum Genomes to run TranscriptClean in variant-aware mode (--canonOnly + defaults) ...
-
bioRxiv - Microbiology 2021Quote: ... indexed with a set A Nextera XT Index Kit (v2, Illumina), quantified and pooled in equal amounts for sequencing ...
-
bioRxiv - Biophysics 2020Quote: ... These two read sets (the MiSeq and the HiSeq Illumina datasets) composed the data for gene assembly.
-
bioRxiv - Microbiology 2020Quote: ... and one of a set of reverse oligonucleotides containing Nextera (Illumina) indices (JW8054 ...
-
bioRxiv - Genomics 2022Quote: ... We added the Illumina TruSeq Nano (Set A) (Illumina, cat # 20015960) indices to each sample in a combination appropriate for pooling and amplified using 9 cycles of PCR ...
-
bioRxiv - Plant Biology 2023Quote: ... and together with TruSeq DNA Sgl Index Set A/B (Illumina) to perform adapter ligation ...
-
bioRxiv - Immunology 2023Quote: ... and Nextera XT v2 set A Indexing kit (Illumina, cat# 15052163). Library quantification and library size were measured using Qubit DNA HS kit (Thermofisher Scientific ...
-
bioRxiv - Genetics 2023Quote: ... with Index Primers from Illumina (IDT for Illumina DNA/RNA UD Indexes Set A (Illumina, #20027213)) ...
-
bioRxiv - Genomics 2023Quote: ... Primers were unique pairs of index primers (i5 and i7) from the Nextera XT DNA library preparation kit (Illumina). The PCR amplification conditions were one cycle of 98°C for 45 sec ...
-
bioRxiv - Molecular Biology 2020Quote: ... the NEBNext Ultra II DNA Library Preparation kit was used to generate libraries using 5-10 ng of input or immunoprecipitated DNA and barcode adaptors (NEBNext Multiplex Oligos for Illumina (Set 1, E7335 and Set 2, E7500)) ...
-
bioRxiv - Genetics 2021Quote: ... Individual sequencing barcodes were added to each sample by amplifying the entire 40 μL elution in a 100 μL Q5 NEBNext reaction with 0.5 μM of TruSeq_Universal_Adapter primer and a reverse primer containing a unique 8 bp index (Illumina_Multiplex, Supplementary Table 14) for sample demultiplexing post-sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5ul of 10uM NEB universal primer and 10uM NEB index primer (in NEBNext Multiplex Oligos for Illumina, NEB E7335, E7500), 0.5ul of Phusion DNA polymerase and 21.5ul H2O ...
-
bioRxiv - Genomics 2022Quote: ... 600 pg of product were tagmented with barcoded N7 primers and P5-index-seq1 primers using the Nextera XT kit (Illumina). BRB-seq libraries were sequenced on a Novaseq 6000 paired-end with 28 x 91 reads.
-
bioRxiv - Molecular Biology 2021Quote: ... 2.5 µL of 10 µM primer mix (515F forward and 806R reverse rRNA gene V4 primers with Illumina MiSeq adaptors), and 30 ng of sample DNA ...
-
bioRxiv - Systems Biology 2021Quote: ... Fragments were amplified using a P5-SMART primer (Table S2) and an i7 indexed P7 adapter primers (Illumina, Table S2) at 0.75 µM in KAPA HiFi ready mix (PCR program table S4) ...
-
bioRxiv - Neuroscience 2020Quote: ... In our study these NGS primer pairs consisted of eight different forward and 12 different reverse primers (based on Illumina adapters [N/S/E]501-[N/S/E]508 and N701-N712) ...
-
bioRxiv - Cell Biology 2023Quote: ... with forward primers designed with a TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG overhang and reverse primers with a GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG overhang encoding adaptors for Nextera XT Indexing (Illumina). Primers are listed in Supplementary Table 5 ...
-
bioRxiv - Genetics 2023Quote: ... A nested PCR approach was used where a larger section of the U6 region was amplified and then performed PCR1 with DeepSeq primers (primers with a complimentary Illumina sequence for i7 and i5 sequencing primer attachment ...
-
bioRxiv - Systems Biology 2024Quote: ... Libraries were run on an Illumina Nextseq 550 instrument using the MetSeq Primer 1 (NuGEN) mixed with the Read 1 primer (Illumina) according to the Ovation RRBS Methyl-Seq System 1-16 protocol for the first read and the Read 2 primer (Illumina ...
-
bioRxiv - Biophysics 2021Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Table S1) ...
-
bioRxiv - Immunology 2021Quote: ... 2μL of 10μM RPI library specific primer (Illumina) and 1.3μL water using the following thermocycling conditions ...
-
bioRxiv - Immunology 2021Quote: ... 2μL of 10μM RPI library specific primer (Illumina) and 1.3μL water using the following thermocycling conditions ...
-
bioRxiv - Microbiology 2019Quote: ... The16S amplicon forward and reverse primers from Illumina were used in first round of PCR for 8 cycles ...
-
bioRxiv - Genetics 2020Quote: ... and amplified with the inner primer pair (Illumina P5 + bait-specific P7 index-attached reverse primer ...
-
bioRxiv - Genomics 2021Quote: ... 1 μL 12.5 μM Nextera Ad1 primer (Illumina), 1 μL 12.5 μM Nextera Ad2 barcoded primer (Illumina) ...
-
PD-1 checkpoint blockade disrupts CD4 T cell regulated adaptive B cell tolerance to foreign antigensbioRxiv - Immunology 2021Quote: ... 2μL of 10μM RPI library specific primer (Illumina) and 1.3μL water using the following thermocycling conditions ...
-
bioRxiv - Microbiology 2020Quote: ... (Note that many of the primers include Illumina Nextera linkers used to prepare sequencing libraries.)
-
bioRxiv - Microbiology 2022Quote: ... The P2 BarSeq primers allowed demultiplexing by Illumina software.9 The P1 BarSeq primers contained an additional index checked by the MultiCodes.pl script.63 All PCRs were pooled equally in volume and column-cleaned ...
-
bioRxiv - Biophysics 2022Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Supplementary Table 1) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Read 1 was read with primer HP6 (Illumina) with 3 dark cycles (first 3 bases of read 1 were not read) ...
-
bioRxiv - Biophysics 2023Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (Supplementary Table 3 ...
-
bioRxiv - Genomics 2024Quote: ... 2.5Lμl of 10LμM TruSeq Universal Adapter primer (Illumina), 3.5Lng barcode cDNA and nuclease-free water to a total volume of 50 μl ...
-
bioRxiv - Biochemistry 2024Quote: ... and TruSeq i5 and i7 indexing primers (Illumina) following the cycling conditions ...
-
bioRxiv - Plant Biology 2019Quote: ... LMP sequencing was also conducted using one set of Nextera libraries (Illumina) from gDNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... Libraries were prepared using NEBNext Multiplex Small RNA Library Prep Set (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and the Nextera Index Kit v2 Set A (Illumina, #FC-131-2001). Aliquots of the tagmented and adaptor ligation PCR product were pooled (Each 96 well plate was pooled into a single 1.5mL microcentrifuge tube) ...
-
bioRxiv - Plant Biology 2023Quote: ... and together with Illumina TruSeq DNA sgl Index Set A/B (Illumina) to perform adapter ligation ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Nextera XT Index Kit v2 Set B (FC-131-2002, Illumina). 1.5 µl Nextera PCR Master Mix and 0.5 µl of a unique combination of primers were added to each well using the I.DOT and tagmented cDNA was amplified in a C1000 Thermal Cycler (72 °C for 3 min ...
-
bioRxiv - Microbiology 2023Quote: ... Barcodes of the Illumina NexteraTM DNA UD index set A-D (Illumina) were diluted 1:5 prior to the library amplification ...
-
bioRxiv - Genomics 2024Quote: ... with IDT for Illumina UD Indexes (96x, Plate A, Set 1, Illumina). Library size selection was performed to remove fragments below 180 bp and above 700 bp using AMPure XP beads (Beckman coulter) ...