Labshake search
Citations for Illumina :
301 - 350 of 1953 citations for 7H Benzocyclohepten 7 one 2 amino 5 6 8 9 tetrahydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... a targeted exome panel sequencing was performed by Next Generation Sequencing using the TrueSight One Sequencing Panel (Illumina). The results were compared with the reference sequence of the human TRPM4 gene (MIM# 606936 ...
-
bioRxiv - Neuroscience 2023Quote: ... Libraries from up to twelve 96-well plates were sequenced on one MiSeq run (Illumina, San Diego, CA) with paired-end 300 bp sequencing reads (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sequencing libraries were constructed with barcodes to allow multiplexing samples on one lane and were processed by Illumina Miseq sequencer following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... We loaded the cancer patient samples on one lane of a NovaSeq 6000 (Illumina, San Diego, CA, USA) instrument at a concentration of 300 pM with 10% PhiX using the NovaSeq 6000 SP Reagent Kit v1.5 (100 cycles ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and all samples were run on one lane of the NovaSeq6000 S4 v1.5 (Illumina, San Diego, United States).
-
bioRxiv - Microbiology 2020Quote: ... was performed with ~8 million reads / sample in single-end mode on the NextSeq 500 platform (Illumina) with the High Output Kit v2.5 (75 Cycles).
-
bioRxiv - Microbiology 2021Quote: ... pooled and sequenced using two lanes of HiSeqX (Illumina; 150bp paired-end; read length 28*8*91). Two biological replicates of each L ...
-
bioRxiv - Genetics 2022Quote: ... Individual sequencing barcodes were added to each sample by amplifying the 20 μL elution in a 50 μL Q5 NEBNext reaction with 0.5 uM of TruSeq_Universal_Adapter primer and a reverse primer containing a unique 8 bp index (Illumina_Multiplex) for sample demultiplexing post-sequencing ...
-
bioRxiv - Cancer Biology 2019Quote: ... gene expression analysis was performed using Illumina’s Mouse Ref 8 Beadchip v1 (Illumina Inc, San Diego, CA). These datasets have been deposited in GEO as accession entry GSE22520 and described in Supplemental Table 1c ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Samples with a RIN >8 was outsourced to Novogene for library construction and sequencing (Illumina Platform (PE150)) with 20 M raw reads/sample ...
-
bioRxiv - Biophysics 2021Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl Nextera i5 primer (S5xx, Illumina), and 5 μl of a custom i7 primer mix (0.5 μM i7_BCx + 10 μM i7_primer ...
-
bioRxiv - Biophysics 2022Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Biophysics 2023Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples (GJJ_1J) ...
-
bioRxiv - Cancer Biology 2023Quote: With the exception for Whole Transcriptome Amplification Analysis (WTA)7 (sent to Novogene and sequenced on a S4 flowcell of an Illumina Novaseq), all single-cell or bulk sequencing was prepared as ready-made libraries and sequenced either on Illumina Novaseq or Nextseq 500 instruments at the Functional Genomics Center Zurich ...
-
bioRxiv - Genomics 2021Quote: ... One µg of total-RNA was used for RNA library preparation with TruSeq® Stranded mRNA Library Prep (Illumina), following the protocol according to the manufacturer ...
-
bioRxiv - Cell Biology 2022Quote: ... One microgram of total DNAse-treated RNA was then prepared with the TruSeq Stranded mRNA Library Prep Kit (Illumina). Poly-A RNA was purified and fragmented before strand specific cDNA synthesis ...
-
bioRxiv - Neuroscience 2022Quote: ... Libraries from four 10x channels were pooled together and sequenced on one lane of an Illumina HiSeq X (Illumina) by the Genomics Platform of the Broad Institute.
-
bioRxiv - Cancer Biology 2020Quote: ... All TCR enriched libraries were equimolarly pooled and sequenced in one sequencing run using NovaSeq6000 S2-Xp 100 (Illumina) as required lower sequencing depth of 5,000 read pairs per sample ...
-
bioRxiv - Developmental Biology 2022Quote: ... Sequencing was peformed by Edinburgh Genomics (University of Edinburgh) on one lane of a NovaSeq 6000 Sequencing System (Illumina) with the following cycle setup for paired-end reads ...
-
bioRxiv - Genomics 2019Quote: ... One microgram of total RNA was subjected to rRNA removal using the Ribo-Zero Gold rRNA Removal kit (Illumina). Strand specific RNA-seq libraries were constructed using NEBNext Ultra II Directional Library Prep Kit (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... (iii) and one TruSeq Synthetic Long-Read library were prepared according to the kit’s specifications and sequenced by Illumina sequencing technology ...
-
bioRxiv - Genetics 2020Quote: ... One microgram of total RNA was used for library preparation following the TruSeq Stranded mRNA Sample Preparation Protocol (Illumina). Sequencing was performed on an Illumina HiSeq 2000 platform at Wageningen University & Research ...
-
bioRxiv - Genomics 2021Quote: ... The final pool was sequenced on one lane of a NovaSeq 6000 S4 150 bp PE flow cell (Illumina).
-
bioRxiv - Cell Biology 2022Quote: ... Bulk sequencing was run on a NovaSeq 6000 instrument using one lane of an S4 v1.5 flow cell (Illumina), 2B paired-end reads ...
-
bioRxiv - Neuroscience 2023Quote: ... all 30 libraries were pooled and diluted to 3.5 nM for sequencing on one lane of a Hiseq 3000 sequencer (Illumina), using a single read 50 bp and dual indexed sequencing strategy.
-
bioRxiv - Bioengineering 2023Quote: ... 10x libraries were pooled and charged with 1% PhiX on one SP lane of the NovaSeq 6000 instrument (Illumina) using the NovaSeq 6000 SP Reagent Kit v1.5 Raw sequencing data of the modules viability study were processed with Cellranger80 ...
-
bioRxiv - Immunology 2023Quote: ... specifically by % protein coding genes and were sequenced on one lane of NovaSeq6000 S4 PE100 (Illumina, Cat. No. 20028313). Reads were aligned to the mouse genome GRCm38 and quantified using the STAR aligner software version 2.7.2b ...
-
bioRxiv - Microbiology 2024Quote: ... One hundred nucleotides of sequence were determined from both ends of each cDNA fragment using the Novaseq platform (Illumina). Sequencing reads were aligned to the reference genomes (C ...
-
bioRxiv - Microbiology 2019Quote: ... 1889 and H222Δpox1-6 were sequenced with the Genome Analyzer IIx (Illumina, San Diego, USA) by the Göttingen Genomics Laboratory (G2L ...
-
bioRxiv - Genetics 2021Quote: ... 1 µg of high quality total RNA sample (RIN >8) was processed using TruSeq Stranded mRNA kit (Illumina) according to manufacturer instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Library preparation of high-quality RNA (RIN >8) was performed using the TruSeq RNA sample preparation kit (Illumina). Raw sequencing data was aligned to human genome B38 ...
-
bioRxiv - Developmental Biology 2019Quote: ... with RIN values > 8 were subjected to Automated TruSeq stranded total RNA with RiboZero Gold library preparation (Illumina). Single-end 50 bp reads were generated with HiSeq2500 ...
-
bioRxiv - Genomics 2020Quote: ... Genome-wide genotyping of 200 ng genomic DNA from the remaining 207 patients was carried out using Infinium HumanOmni2.5-8 v1.2 BeadChip microarrays (Illumina). After completion of the assay ...
-
bioRxiv - Microbiology 2019Quote: ... and 2×300bp PE Miseq (Illumina) sequencing at UBC Pharmaceutical Sciences Sequencing Centre (Vancouver ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 × 150 bp flow cells (Illumina).
-
bioRxiv - Synthetic Biology 2023Quote: ... 2% PhiX (PhiX Control v3, Illumina) was spiked into the sample and 20 µL were added to an Illumina iSeq 100 i1 Reagent v2 cartridge ...
-
bioRxiv - Neuroscience 2023Quote: ... and sequencing (Illumina HiSeq 2 × 150bp) were all performed at GeneWiz ...
-
bioRxiv - Biochemistry 2024Quote: ... Round 2 primers (Illumina TruSeq Adapters) were added to each reaction to 400 nM ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2×150 cycle strategy (Illumina Inc.). Paired-end reads were produced with a 100x coverage ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Microbiology 2019Quote: ... which was denatured and run on the MiSeq sequencer at a final concentration of 5 pM alongside a 5 pM PhiX control (Illumina). Raw reads generated by MiSeq were error-corrected and filtered using DADA2 through QIIME2 (https://qiime2.org).38 Filtered reads were clustered de novo into Operational Taxonomic Units (OTUs ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2020Quote: ... after which the samples were pooled into one library and subjected to paired-end sequencing using Illumina MiSeq Nano 300 V2 cycle kits (Illumina) at a concentration of 12pM.
-
bioRxiv - Developmental Biology 2021Quote: ... 75-bp single-end sequencing was performed on 12 multiplexed libraries pooled together in one flow cell using a NextSeq 500 high output sequencer (Illumina).
-
bioRxiv - Cell Biology 2020Quote: ... Equal amount of each RNA-seq library was mixed for sequencing in one lane of Illumnia HiSeq3000 in paired-end 150 base mode (Illumina).
-
bioRxiv - Genetics 2021Quote: DNA samples have been obtained from 12,500 individuals and genotyped on one of two DNA microarrays (Affymetrix GeneChip 6.0 or Illumina HumanOmniExpressExome chips). After stringent quality control ...