Labshake search
Citations for Illumina :
301 - 350 of 1976 citations for 7 TRIFLUOROMETHYL 2 3 4 5 TETRAHYDRO 1H BENZO B AZEPINE HYDROCHLORIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... and sequencing (2 × 150 bp, Illumina HiSeq) were performed by Genewiz (South Plainfield ...
-
bioRxiv - Microbiology 2022Quote: ... 2 (Illumina, catalog No. MS-102-2003) by the University of Michigan Microbial Systems Molecular Biology Laboratory as described previously (14) ...
-
bioRxiv - Microbiology 2021Quote: ... 2) merged triplicates for DC3000 + (Illumina only), 3 ...
-
bioRxiv - Microbiology 2022Quote: ... generating 2 × 300bp paired-end reads (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... and sequenced on 2×150 Miseq (Illumina). Clonal abundances were estimated using a pipeline adapted from 110 ...
-
bioRxiv - Molecular Biology 2023Quote: ... or SMART-Seq™ 2 (Illumina, 20040532), followed by NovaSeq (RIP-seq experiments from Figs ...
-
bioRxiv - Immunology 2023Quote: ... and HiSeq2500 V2 2×150bp (Illumina®) protocols at the “Institut du Cerveau” (ICM ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 12.5 pmol each of the following Illumina primers: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG ATCT and 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCT (the underlined parts will hybridize to the two Illumina flowcell oligos). Temperature cycling consisted of 72 ◻C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Illumina sequencing libraries were generated for 5 αHHβHH mice and 5 αLLβHL mice using TruSeq RNA Sample Preparation Kit v2 (Illumina, San Diego, CA, USA) and sequenced on an Illumina HiSeq2500 platform ...
-
bioRxiv - Immunology 2022Quote: ... at endpoints A and B (total 18 samples) was used to construct cDNA libraries with the TruSeq Stranded mRNA kit (Illumina, San Diego, CA) and the indexed fragments were sequenced on the NGS NextSeq 500 (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA-seq libraries were generated from 500 ng of total RNA using the TruSeq Stranded mRNA Library Prep Kit and TruSeq RNA Single Indexes kits A and B (Illumina, San Diego, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... and 1.0 μL of each index primer of the Nextera XT Index Kit v2 Set B and Set C (FC-131-2002, FC-131-2003; Illumina Inc., CA., USA.). The first step ...
-
bioRxiv - Plant Biology 2022Quote: Total RNA was extracted from tomato fruits of WT and bzr1 at MG and B stages and Illumina MiSeq library was constructed as manufacturer’s instructions (Illumina, San Diego, CA, USA) described ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA-Seq libraries were generated from 100 to 300 ng of RNA using TruSeq Stranded Total RNA Library Prep Gold kit and TruSeq RNA Single Indexes kits A and B (Illumina, San Diego, CA), according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA-Seq libraries were generated from 200 ng of total RNA using TruSeq Stranded mRNA Library Prep Kit and TruSeq RNA Single Indexes kits A and B (Illumina, San Diego, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total RNA-Seq libraries were generated from 700 ng of total RNA using TruSeq Stranded Total RNA Library Prep Gold kit and TruSeq RNA Single Indexes kits A and B (Illumina, San Diego, USA), according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... Total RNA-seq libraries were then generated using TruSeq Stranded mRNA Library Prep kit and TruSeq RNA Single Indexes kits A and B (Illumina, San Diego, CA) omitting the poly-A selection step and starting from the fragmentation step ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl water) with 2.5 µl transposase (Illumina 20034197) for 30 min at 37 °C with shaking at 1000 r.p.m ...
-
bioRxiv - Neuroscience 2020Quote: ... An additional 5 samples were sequenced on MiSeq (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... spiked with 5% PhiX pre-made library from Illumina and loaded on a Miseq v3 kit (Illumina Inc. ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl PPC (Illumina Nextera DNA Sample Preparation Kit) and 20 μl DNA ...
-
bioRxiv - Immunology 2022Quote: ... mixed with 5% PhiX and sequenced on MiSeq (Illumina) using MiSeq V3 2 × 300 cycle kit (Illumina).
-
bioRxiv - Genomics 2023Quote: ... 5 µL Tn5 transposase (Illumina Cat FC-121-1030) and 22,5 µL nuclease-free H2O and incubated at 37 °C for 30 mins ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% PhiX control (Illumina, San Diego, CA, USA) along with positive (DNA sample extracted from the healthy gut ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 µM RT Primer (RTP, TruSeq kit; Illumina) was then performed according to the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2019Quote: ... Then perform tagmentation using 2 μl of Tn5 transposase and 12.5 ul 2 × TD buffer (Illumina #FC-121-1031) at 37°C for 1h with 650 rpm shaking ...
-
bioRxiv - Cell Biology 2021Quote: ... with RNA integrity number higher than 7 was used for library preparation using the TruSeq Stranded mRNA Library Preparation Kit (Illumina, San Diego, CA, USA) and sequenced on a NextSEq500 (Illumina) ...
-
bioRxiv - Genomics 2020Quote: ... The pooled library was quality controlled via sequencing at a concentration of 1.7 pM with 35% PhiX on a NextSeq 500 using a mid-output v2 kit (single-end 75 nucleotides, Illumina, San Diego, CA, USA), resulting in an average sequencing depth of 1 million reads ...
-
bioRxiv - Genomics 2020Quote: ... Both re-pooled libraries were then sequenced at a final concentration of 1.7 pM with 25% PhiX on a NextSeq 500 using a high output v2 kit (single-end, 75 nucleotides, Illumina, San Diego, CA, USA), resulting in an average sequencing depth of 9 million reads (range 817 469 – 41.7 million reads).
-
bioRxiv - Immunology 2021Quote: ... Genotyping of the VRC cohort and imputation of genetic variants are described in detail elsewhere.55 We interrogated 7,637,921 variants (imputed from 2,783,635 genetic variants with a minor allele frequency ≥ 5%, measured using the Illumina Human Omni 5 BeadChip array, GRCh37) for an association with each of the 166 ToxScan peptides using the penalized quasi-likelihood (PQL ...
-
bioRxiv - Cancer Biology 2020Quote: ... mRNA expression (RNA-Seq level 3 data) and DNA methylation (Illumina HumanMethylation450 array) data of 33 types of cancers (n=10,528 ...
-
bioRxiv - Genomics 2021Quote: ... Lab 3 sequenced DNA on a NextSeq 550 (Illumina, San Diego, CA, USA), paired-end 2×75 bp ...
-
bioRxiv - Molecular Biology 2020Quote: Create CSV files listing of all 3 sets of barcodes (Illumina, plate, well)
-
bioRxiv - Neuroscience 2023Quote: ... cDNA libraries were prepared using a 3′-Tag-RNA-Seq library kit (Illumina). Sequencing was performed using one lane of a Hi-Seq 4000 platform with pair-end 40 bp reads ...
-
bioRxiv - Genomics 2023Quote: ... and combined with PhiX control (v.3, Illumina Inc, San Diego, CA, USA) at a final concentration of 1% ...
-
bioRxiv - Genomics 2022Quote: ... The library was run across 4 lanes of a NovaSeq (Illumina), multiplexed with other samples.
-
bioRxiv - Molecular Biology 2022Quote: ... by adding 4 μl of 1× CircLigase II Buffer (Epicentre/Illumina), 2 μl of 50mM of MnCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... puteoserpentis (499ROV/1-4) specimens using short-read (Illumina HiSeq 3000) and long-read (PacBio ...
-
bioRxiv - Microbiology 2023Quote: ... Ribosomal RNA depletion with additional probes recommended by Illumina (Table 4), stranded library preparation (Illumina Ribo-Zero Plus rRNA Depletion w/ Stranded Total RNA) ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were subsequently sequenced (2 x 150 bp or 2 x 200 bp paired-end reads) using a MiSeq (Illumina) equipment.
-
bioRxiv - Synthetic Biology 2022Quote: ... using Qiagen RNeasy Plus kit.200ng of extracted RNA was used to produce SARS-CoV-2 amplicon libraries using the NEBNext SARS-CoV-2 FS Library Prep Kit (Illumina) using the VarSkip Short Express Protocol with 25 minutes fragmentation step and 8 cycles of PCR enrichment ...
-
bioRxiv - Immunology 2020Quote: ... using NextSeq 500/550 v2.5 sequencing reagent kit (read length: 2 × 75 bp) or NovaSeq S1 sequencing reagent kit (read length: 2 × 100 bp) (Illumina) respectively ...
-
bioRxiv - Immunology 2020Quote: ... Sequencing was performed in a high-throughput MiSeq machine using either a v2 Nano reagent kit 2×250bp or a v3 reagent kit 2×300bp (Illumina) at the Genomic Research Unit (GRU ...
-
bioRxiv - Genomics 2020Quote: ... Pooled library sizes were selected (2% gel, BluePippin, Sage Science) and sent for 2 × 150-bp deep sequencing (Miseq, Illumina).
-
bioRxiv - Genomics 2021Quote: ... TrueSeq libraries were then sequenced as necessary for their desired length as paired end 2×151 and 2×301 read multiplex runs on MiSeq platform (Illumina) for pre-cursor and mature MAPT isoforms respectively ...
-
bioRxiv - Microbiology 2022Quote: ... and sequenced as 2 × 150 bp reads on the MiSeq sequencing instrument using the MiSeq Micro kit version 2 (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... the library was sequenced on an Illumina MiSeq with a MiSeq Reagent Kit v.2 (2 × 250 bp; Illumina Inc.). A total of 3.27 x 106 paired-end reads were obtained ...
-
bioRxiv - Microbiology 2022Quote: ... was combined with short-read whole-genome sequencing data for the 169 individuals (2×125 bp or 2×150 bp Illumina paired-end sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were sequenced on the Illumina NextSeq550 (2×75bp) (Plateforme Transcriptome, IRMB, Montpellier, France) or NovaSeq 6000 (2×75bp) (Illumina) at the CNAG ...
-
bioRxiv - Microbiology 2020Quote: ... the number of intervening days between serial isolations, time point (A or B, being earlier and later time points respectively) and sequencing technology (Illumina [I] or PacBio[P]) (Figure 3B) ...