Labshake search
Citations for Illumina :
301 - 350 of 1374 citations for 2 2 4 Dibromophenoxy methyl tetrahydro 2H pyran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2023Quote: ... Final pool was sequenced using the 2×151 bp P1 reagent (20050264, Illumina, USA) and NextSeq2000 sequencer ...
-
bioRxiv - Microbiology 2023Quote: ... (California, USA) for library prep and 2×150bp sequencing on a NovaSeq6000 (Illumina, USA). The run resulted in 21Gb of data with 140,278,770 raw reads ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced using HiSeq 2000 sequencing with 2 × 150 bp paired-end chemistry (Illumina). On average ...
-
bioRxiv - Immunology 2022Quote: Individually indexed libraries were sequenced using the MiSeq V3 2 × 300 cycle system (Illumina). The R1 and R2 reads were processed using the IgDiscover (TCR version) ...
-
bioRxiv - Physiology 2022Quote: ... Libraries were pooled and sequenced paired-ended for 2×75 cycles (Nextseq500 sequencer, Illumina). 30-40 million fragments were generated per sample and quality controls were performed ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Microbiology 2024Quote: ... using the Illumina MiSeq platform with a read length of 2 × 150 bp (Illumina). A subset of 100,000 reads was sampled for each phage ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Microbiology 2024Quote: ... 2 μl of each P5 and P7 primer (Nextera Index Kit, Illumina, CA, USA), 2 μl of initial PCR product ...
-
bioRxiv - Neuroscience 2024Quote: ... using 2 NextSeq 500 High Output Kit 75-cycles (Illumina, Cat# FC-404-1005). Two Nextseq runs were performed to compile enough reads (19-32 million pass-filter reads).
-
The transcriptomic landscape of monosomy X (45,X) during early human fetal and placental developmentbioRxiv - Genetics 2024Quote: ... Libraries were subsequently sequenced on a NovaSeq S2 Flowcell (paired end 2×56bp) (Illumina). All samples in this study were prepared and sequenced at the same time ...
-
bioRxiv - Plant Biology 2023Quote: ... Paired-end reads (2 x 150 bp) were on a HiSeq 3000 instrument (Illumina). Sequencing reads were first quality trimmed and filtered with Trimmomatic (version 0.36 ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced with 2×150 bp paired-end reads on a NovaSeq platform (Illumina).
-
bioRxiv - Biochemistry 2022Quote: ... or NextSeq with 2 × 151 paired-end reads and v2 or v2.5 chemistry (Illumina), and aligned to the hg38 genomic assembly ...
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end sequencing (2 x 100 bp) was carried out with HiSeq 4000 (Illumina), pooling two patients’ samples on one lane ...
-
bioRxiv - Genomics 2022Quote: ... scherzeri were sequenced with 2×150 bp chemistry on the Illumina MiSeq platform (Illumina), respectively ...
-
bioRxiv - Immunology 2022Quote: ... barcoding and sequencing using HiSeq configured for 2×150 bp paired-end reads (Illumina). An average of 28.9 × 106 paired reads was generated per sample with a mean quality score of 35.81 ...
-
bioRxiv - Plant Biology 2022Quote: ... Paired-end reads (2 × 150 bp) were generation on the HiSeq 3000 platform (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... whole SARS-CoV-2 genome cDNA libraries were generated using a MiniSeq system (Illumina) with a MiniSeq mid-output kit ...
-
bioRxiv - Microbiology 2023Quote: ... 2 × 1 μl (concentration of 10pmol/μl) MiSeq Nextera XT adapters (dual indexed, Illumina), and 6.5 μl of mQ water (Ultrapure) ...
-
bioRxiv - Cancer Biology 2023Quote: ... libraries were sequenced 2 x 150 paired end using a NovaSeq 6000 instrument (Illumina) to get 30x coverage on the genome ...
-
bioRxiv - Microbiology 2023Quote: ... Transposon mutant 19_H4 was sent for whole genome sequencing (Illumina; 2 X 151 bp) to identify the insertion site of the transposon.
-
bioRxiv - Bioengineering 2023Quote: ... Libraries were then sequenced on NextSeq 500 Mid Output with 2×150 bp (Illumina). The Cell Ranger VDJ pipeline was used for sample de-multiplexing and barcode processing.
-
bioRxiv - Developmental Biology 2024Quote: ... The resulting sequencing library were performed pair-end sequenced (2 x 150bp) by Illumina NovaSeq instruments at Novogene Bioinformatics Institute ...
-
bioRxiv - Genetics 2024Quote: ... These pooled libraries underwent 2 × 250 bp sequencing (Illumina HiSeq 2500, Psomagen, Rockville, MD).
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of isolated genomic DNA sample and 100 nmol of each primer (WISH_Illumina_fwd and WISH_Illumina_rev ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of isolated genomic DNA sample and 100 nmol of each primer (WISH_Illumina_fwd and WISH_Illumina_rev ...
-
bioRxiv - Neuroscience 2024Quote: ... and pooled equimolar to 2 nM for single-read sequencing on the HiSeq4000 (Illumina) with settings 51-8-8 ...
-
bioRxiv - Microbiology 2024Quote: ... and 2 × 150 nucleotides paired-end sequencing on a HiSeq4000 platform (Illumina Inc., USA) were carried out as communicated previously (Bhattacharya et al ...
-
bioRxiv - Microbiology 2024Quote: ... and passed to paired-end sequencing (2 × 150 bp) on a NovaSeq6000 platform (Illumina). On average ...
-
bioRxiv - Microbiology 2024Quote: ... The samples were paired-end sequenced (2 x 300 bp) on a MiSeq (Illumina) using a MiSeq Reagent kit v3 (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... Paired-end sequencing (2 × 149 bp) was performed on a NextSeq 550 system (Illumina) using high-output flow cells ...
-
bioRxiv - Microbiology 2024Quote: ... The samples were paired-end sequenced (2×300 bp) on a MiSeq (Illumina, USA) using a MiSeq Reagent kit v3 (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... and paired-end sequencing (2 × 300 bp) was conducted via Illumina MiSeq (Illumina, USA) at the Institute of Clinical Molecular Biology (IKMB ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pellet was incubated in the transposase reaction mix (25µL 2×TD buffer (Illumina), 2.5µL transposase (Illumina Cat# FC-121-1030 ...
-
bioRxiv - Genomics 2021Quote: ... All DNA methylation data was generated using the TruSeq Methyl Capture EPIC kit (FC-151-1003, Illumina) according to manufacturer’s protocol [62] ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 ng of ssDNA was used as input for the Epicenter EpiGnome™ Methyl-Seq Kit (Illumina, EGMK81312 ...
-
bioRxiv - Molecular Biology 2022Quote: Equimolar amounts of libraries for Enzymatic Methyl-seq were first sequenced on the iSeq 100 instrument (Illumina) using paired-end sequencing of 2x151 to assess both library and pooling qualities ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA samples were further processes according to the TruSeq Sample Preparation v.2 Guide (Illumina) and paired end-sequenced on the HiSeq 2500 (Illumina).
-
bioRxiv - Cell Biology 2020Quote: ... Small RNA libraries were diluted to 2 nM and run on a miSeq System (Illumina) for NGS using the V2 kit (Illumina) ...
-
bioRxiv - Genetics 2021Quote: ... Libraries were then sequenced with 2×150bp paired-end reads on an Hiseq3000 instrument (Illumina).
-
bioRxiv - Genetics 2021Quote: ... Libraries were prepared with a TruSeq RNA Library Prep Kit version 2 (Illumina RS-122) and sequenced on an Illumina HiSeq4000 in paired-end mode (PE150).
-
bioRxiv - Evolutionary Biology 2021Quote: ... with 300 cycle mid-output (2×150 bp) NextSeq Reagent kits v2 (Illumina Corporation, 20024905). FASTQ files of raw sequencing data were deposited in NCBI database with the Sequence Read Archive (SRA ...
-
bioRxiv - Developmental Biology 2021Quote: ... followed by paired-end sequencing (2 x 75 bp) performed with Nextseq 500 (Illumina, USA). Libraries were sequenced in triplicate ...
-
bioRxiv - Genomics 2020Quote: ... The samples were then sequenced (2×101 cycles, paried end reads) on the HiSeq2500 (Illumina) using the TruSeq SBS Kit v3-HS 200 cycles Kit (Illumina) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2×150bp paired-end sequencing (PE150) was performed on an Illumina Novaseq™ 6000 (Illumina) following the vendor’s recommended protocol.
-
bioRxiv - Genomics 2020Quote: ... Paired end libraries (2×150 bp) were sequenced on an Illumina HiSeq4000 instrument (Illumina Inc.).
-
bioRxiv - Genomics 2020Quote: ... Paired-reads (2×100 bp) were sequenced on the NovaSeq 6000 S2 flowcell (Illumina, Inc.). DNA and RNA library preparation and sequencing were performed at the SNP&SEQ Technology Platform in Uppsala ...
-
bioRxiv - Microbiology 2020Quote: ... and sequenced as 2 × 150 base pair reads on the Illumina NextSeq 550 instrument (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... and sequenced with 2×250 bp cycles of v2 Miseq chemistry (Illumina, San Diego, CA). Replicate reactions from each sample were pooled and gel purified using the Blue Pippin Prep system (Sage Science ...