Labshake search
Citations for Illumina :
251 - 300 of 2229 citations for SARS CoV 2 Spike Glycoprotein S1 His tag Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... The construction of libraries was performed with Illumina preparation kits (Table S1) following the manufacturer’s recommendations (Illumina Inc., San Diego, CA, USA). The Nextera DNA Prep kit and Illumina DNA Prep were used for WGS ...
-
bioRxiv - Microbiology 2022Quote: Amplicon libraries were prepared according to (16) using published 16S and 18S rRNA gene primers (Table S1) and by sequencing via the MiSeq platform (Illumina Inc., USA). Raw sequence reads were processed following a bioinformatic pipeline in Deng et al ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing was performed on an Illumina NovaSeq 6000 instrument using the NovaSeq 6000 S1 Reagent Kit v1.5 (200 cycles) (Illumina, cat. no. 20028317), in a pair-end 2x100 cycle mode ...
-
bioRxiv - Microbiology 2019Quote: ... Illumina recommended denaturation and loading recommendations which included a 1% PhiX spike in (PhiX Control v3 Illumina Catalogue FC-110-3001). Whole genome sequencing data has been deposited in the Sequence Read Archive under PRJNA529870.
-
bioRxiv - Microbiology 2020Quote: ... ChIP-seq libraries were sequenced on the Illumina NextSeq 500 system with a 20% phiX spike-in (Illumina, FC-110-3001) to generate 75 bp single-end reads (NextSeq 500/550 High Output v2 kit) ...
-
bioRxiv - Genomics 2019Quote: ... paired-end mode with R1 67 and R2 8) at 1.8 pM loading concentration with 2.5% PhiX spike-in (PhiX Control V3 [Illumina FC-110-3001]) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... purified and sequenced on a single lane on an Illumina Hi-Seq 2500 (Illumina Inc, USA) with single-end 100 bp reads ...
-
bioRxiv - Genomics 2020Quote: Hi-C data were obtained in the form of unprocessed fastq files (paired-end Illumina reads) for IMR90 cells from the NCBI Gene Expression Omnibus (GEO)-accession GSE43070[12] ...
-
bioRxiv - Genomics 2024Quote: ... The production-scale sequencing of the Hi-C library was performed on a NextSeq2000 sequencer (Illumina) using 150 bp paired-end read mode at the Berlin Center for Genomics in Biodiversity Research.
-
bioRxiv - Microbiology 2024Quote: ... Hi-SC2 libraries were prepared and subjected to pair-end sequencing on a NextSeq 500 (Illumina). After sequencing ...
-
bioRxiv - Immunology 2022Quote: ... Sequencing was carried out on a Novaseq6000 S2 2×50bp flow cell (Illumina) utilizing the Chromium single-cell 5′ gene expression library preparation (10X Genomics) ...
-
bioRxiv - Immunology 2022Quote: ... Sequencing was carried out on a Novaseq6000 S2 2×50bp flow cell (Illumina) utilizing the Chromium single-cell 5′ and TCR gene expression library preparation (10X Genomics) ...
-
bioRxiv - Genomics 2020Quote: ... Deep- and shallow-sequence libraries were pooled separately and sequenced on either Illumina HiSeq 2500 or HiSeq 4000 (Table S1, Illumina, San Diego, CA).
-
bioRxiv - Evolutionary Biology 2022Quote: ... We sent 100 ng of DNA from 289 sapsuckers (Supplemental Materials Table 1) to Genome Quebec for sequencing on either an Illumina HiSeq4000 PE150 or the NovaSeqSP 6000 PE150 (Table S1) (Illumina, San Diego, CA).
-
bioRxiv - Genomics 2021Quote: The full-coding region of 48 CRC-related genes (Supplementary Table S1) was sequenced using a MiSeq platform (Illumina, San Diego, CA, USA) on a subset of 44 unpaired tumor samples ...
-
bioRxiv - Cell Biology 2023Quote: ... Editing frequencies in samples collected following transplantation were assessed via deep sequencing of PCR amplified libraries of the CD33 gRNA target region (Table S1) on an Illumina Miseq (Illumina, San Diego, CA) via 300bp paired end reads and a median sequencing depth of 100,000 reads/gRNA target site ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing was performed using Pair-end 2×100 cycle mode on the Illumina NovaSeq 6000 system (NovaSeq 6000 S1 Reagent Kit v1.5 200 cycles Illumina, cat. no. 20028317; 0.5% of the PhiX control library, Illumina, cat. no. FC-110-3001) and the standard clustering procedure.
-
bioRxiv - Genomics 2020Quote: ... 10 pM DNA library was prepared under Denature and Dilute Libraries Guide of Illumine MiSeq System with 15% PhiX spike-in control (Illumina, CA, USA) and eventually subjected to 250 bp pair-end sequencing on a MiSeq lane (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were multiplexed and sequenced with a 15% spike-in of PhiX DNA in an Illumina NovaSeq platform (Illumina, San Diego, CA) using a 200 cycle single-end read at the same facility ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... trim regions with average quality scores below Q10 from both ends of reads and to filter out reads aligning to PhiX-174 genome (a commonly used spike-in control in Illumina sequencing runs). After filtering ...
-
bioRxiv - Genomics 2019Quote: ... libraries were prepared according to the manufacturer’s instructions with a 1% spike-in of the ϕX174 control library (Illumina #FC-110-3002) and sequenced on an Illumina NextSeq 500 instrument with a High Output v2 reagent kit (Illumina #FC-404-2005) ...
-
bioRxiv - Genomics 2021Quote: ... and (3) 134 Gb (~100× depth) chromosome conformation capture sequencing (Hi-C) data (sequenced by Illumina platform).
-
bioRxiv - Neuroscience 2019Quote: ... Paired-end 100 bp sequencing reads were obtained using Illumina Hi-seq 2500 (Illumina, San Diego, CA).
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were sequenced on the Illumina Hi-Seq 2500 Next-Generation-Sequencer (Illumina, San Diego, CA, USA) using 50bp single-end sequencing.
-
bioRxiv - Genomics 2022Quote: ... Chromosome-scale scaffolding was then performed by HiRise44 with Hi-C reads obtained from HiSeq 2500 (Illumina).
-
bioRxiv - Evolutionary Biology 2022Quote: ... We confirmed all strains had marker-less deletions by PCR followed by Sanger sequencing (primers given in Table S1) and Next Generation Sequencing (Illumina HiSeq PE150, >30x coverage). We used P1 transduction to transfer modifying enzyme (ME ...
-
bioRxiv - Microbiology 2023Quote: DNA samples were sent for amplicon sequencing of the V6-V8 16S rRNA region using staggered primers (Table S1) by the Genome Quebec Innovation Centre using an Illumina MiSeq platform (Illumina Inc., San Diego, CA) and analyzed using an established QIIME 2 pipeline (21 ...
-
bioRxiv - Genomics 2019Quote: ... with default settings from Illumina HiSeq 50x (downsampled to two flow cells) 2×150 bp data and from Illumina HiSeq 45x 2×250 bp data for the AJ trio ...
-
bioRxiv - Genomics 2020Quote: Messenger RNA capture based libraries were prepared starting from 8.5 µL DNase treated and spike-in supplemented RNA eluate using the TruSeq RNA Exome Library Prep Kit (Illumina, San Diego, CA, USA). Each sample underwent individual enrichment according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... libraries were prepared according to the manufacturer’s instructions with a 1% ϕX174 spike-in and sequenced on an Illumina MiSeq instrument with a Reagent Kit v3 (Illumina #MS-102-3001), reading 169 nt for read 1 and 6 nt for the P7 index read.
-
bioRxiv - Cancer Biology 2020Quote: ... and sequenced on Illumina next-generation sequencing platforms with a 20% spike-in of PhiX control DNA (Illumina, cat. no. FC-110-3001). All sequencing runs used a dual-index configuration and a custom Read 1 primer (5’ GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAG 3’ ...
-
bioRxiv - Microbiology 2022Quote: ... Purified libraries were sequenced on Illumina MiSeq platform (reagent kits: v2 300-cycles, paired-end mode) at 8 pM loading concentration with 25% PhiX spike-in (Illumina FC-110-3001). Custom sequencing primers were spiked into reagent cartridge (well 12 ...
-
bioRxiv - Systems Biology 2023Quote: ChIP-seq and input libraries were sequenced on the Illumina NextSeq 500 system with a ∼20% phiX spike-in (Illumina, FC-110-3001) to generate 75 bp single-end reads (NextSeq 500/550 High Output v2 kit) ...
-
bioRxiv - Microbiology 2023Quote: ... (Text S1.), while sequencing was performed at the Swedish National Genomics Infrastructure (NGI) (Uppsala, Sweden) on Illumina MiSeq platform (Illumina Inc, San Diego, CA, USA) in a 2×300 bp paired-end format and with v3 chemistry.
-
bioRxiv - Genomics 2020Quote: ... Sequencing of the Hi-C library was conducted on an Illumina HiSeq 2500 (Illumina, San Diego, CA, USA) with 101 bp paired-end reads ...
-
bioRxiv - Genomics 2022Quote: ... we further sequenced the same libraries on a single lane of rapid flowcell in Hi-seq 2500 (Illumina) at Otago Genomics Facility (OGF) ...
-
bioRxiv - Immunology 2019Quote: ... The eight capture pools were then pooled equimolar and sequenced across two Illumina HiSeq2500 v2 150bp single-end rapid lanes with a ten percent PhiX control library spike (Illumina Inc., San Diego, CA). Basecall files (bclfiles ...
-
bioRxiv - Genomics 2020Quote: Small RNA libraries were prepared starting from 5 µL DNase treated and spike-in supplemented RNA eluate using a TruSeq Small RNA Library Prep Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol with two minor modifications(1) ...
-
bioRxiv - Genomics 2021Quote: ... Illumina Catalogue FC-404-2003) following the Illumina recommended denaturation and loading recommendations which included a 1% PhiX spike (PhiX Control v3 Illumina Catalogue FC-110-3001).
-
bioRxiv - Genomics 2022Quote: ... Illumina Catalogue FC-404-2003) following the Illumina recommended denaturation and loading recommendations which included a 1 % PhiX spike in (PhiX Control v3 Illumina Catalogue FC-110-3001). Data was uploaded to Basespace (www.basespace.illumina.com ...
-
bioRxiv - Microbiology 2023Quote: ... The library was then diluted to a concentration of 15 pM and sequenced with a 15% PhiX spike-in on an Illumina MiSeq sequencing platform using the MiSeq Reagent Kit v3 (600 cycles) (Illumina, Inc., San Diego, CA). The resulting read lengths were 301 bp (forward sequences) ...
-
bioRxiv - Microbiology 2020Quote: ... WGS libraries were sequenced with paired-end 150 base pair reads on an Illumina NovaSeq 6000 by the UW Biotechnology Center (Illumina NovaSeq 6000 S1 Reagent Kit v1.5).
-
bioRxiv - Neuroscience 2020Quote: ... before single-end sequencing to generate 50 bp reads on the Hi-Seq 4000 platform (Illumina, San Diego, USA).
-
bioRxiv - Genetics 2020Quote: ... The libraries were pooled and loaded at a concentration of 1.8pM with 10% PhiX spike-in for sequencing on an Illumina NextSeq 550 System using Illumina NextSeq 150 Cycle Hi-Output v2.5 kits (Illumina) to achieve a targeted read depth of ∼33,000 reads per nucleus ...
-
bioRxiv - Plant Biology 2023Quote: ... The 5μg total RNA (DNase-treated) was outsourced for the RNA-Seq on Hi-Seq 2000 genome analyzer (Illumina) sequencing platform ...
-
bioRxiv - Genomics 2023Quote: ... about 40 ng purified pre-amplified Hi-C sample was fragmented in two 50 μl tagmentation mix (1x TD buffer and 0.5 μl TDE1 (Illumina Tagment DNA TDE1 Enzyme and Buffer Kit ...
-
bioRxiv - Genomics 2023Quote: ... and sequenced by PacBio Sequel II. Hi-C libraries were prepared following a standard protocol (Belton et al. 2012) and sequenced by Illumina HiSeq 4000 (Illumina ...
-
bioRxiv - Immunology 2019Quote: Single-cell RNA-sequencing libraries were generated using the 10x Genomics Single Cell 3’ Solution (version 2) kit and sequenced to an average depth of > 200k reads/cell (Illumina HiSeq 4000). Data analysis was performed using Python3 pipelines (https://github.com/sansomlab/tenx ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 (Illumina) were used for construction of complementary DNA libraries and the complementary DNA libraries were sequenced on a NextSeq 500 system (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 (Illumina) and the HiSeq Rapid SBS Kit v2-HS (Illumina ...