Labshake search
Citations for Illumina :
251 - 300 of 940 citations for Human Immunodeficiency Virus Reverse Transcriptase Protein HIV 1 Clade B IIIB since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Coding and non-coding drivers of mantle cell lymphoma identified through exome and genome sequencingbioRxiv - Genomics 2019Quote: ... we used the Agilent SureSelect Human All Exon kits for library preparation and HiSeq2000 instruments (Illumina) for sequencing ...
-
bioRxiv - Immunology 2019Quote: ... Hybridization of the cRNA was performed on an Illumina Human-HT12 Version 4 chip set (Illumina). Microrarray data were exported from GenomeStudio (Illumina ...
-
bioRxiv - Genetics 2019Quote: ... The sample was genotyped on the Illumina Human Core Exome Array (Illumina, San Diego, CA, US). GWAS QC was performed using standard methods and imputation was done using the HRC panel [63] on the Sanger Imputation server (https://imputation.sanger.ac.uk/) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... DNA methylation was quantified using Infinium® Human Methylation 450K BeadChip (Illumina Inc.; San Diego, CA).
-
bioRxiv - Molecular Biology 2020Quote: ... Obtained RNA was depleted of rRNAs with Ribo-Zero Gold Kit (Human/Mouse/Rat) kit (Illumina), separated in 17% Urea gel and stained with SYBR Gold (Invitrogen) ...
-
bioRxiv - Pathology 2021Quote: ... Ribosomal RNA depletion was carried out solely using the RiboZero Gold Human/Mouse/Rat kit (Illumina). Adapter sequences were based on the TruSeq small RNA sequences (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA depletion was conducted with the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) for human and mouse samples and with Caenorhabditis elegans Ribo-Seq riboPOOLs (siTOOLs Biotech ...
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA sequencing was performed at BCM Human Genome Sequencing Center using NovaSeq 6000 platform (Illumina). The raw fastq files were first quality checked using FastQC v0.11.8 software (http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/) ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA depletion was performed with the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, accompanied by TruSeq Stranded Total RNA Kit) ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA depletion was conducted by the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, accompanied by TruSeq Stranded Total RNA Kit) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genome-wide DNA methylation was analysed on 850000 CpGs with the Infinium Human MethylationEPIC Kit (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2024Quote: ... combined with methylation data collected from the public TCGA LUAD study (Illumina Human Methylation 450k BeadChip) (Supplementary Table 1) ...
-
bioRxiv - Genomics 2024Quote: Human islet RNA-seq libraries were prepared from total RNA using the stranded TruSeq kit (Illumina). ERCC Mix 1 or Mix 2 spike-ins were randomly added to each sample (Thermo Fisher ...
-
bioRxiv - Bioengineering 2024Quote: The compressed paired-end human mRNA-seq data in fastq format over 80 gigabytes from Illumina PE150 ...
-
bioRxiv - Molecular Biology 2024Quote: ... we used the 318 curated files containing raw human blood expression data (FASTQ containing Illumina reads) of the Bgee project (see supplementary data of (Bastian et al ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Genetics 2021Quote: ... Individual sequencing barcodes were added to each sample by amplifying the entire 40 μL elution in a 100 μL Q5 NEBNext reaction with 0.5 μM of TruSeq_Universal_Adapter primer and a reverse primer containing a unique 8 bp index (Illumina_Multiplex, Supplementary Table 14) for sample demultiplexing post-sequencing ...
-
bioRxiv - Developmental Biology 2021Quote: ... and then indexed using forward (i7) and reverse (i5) index primers from the Nextera Index Kit (Illumina FC-121-1011). Index ligation and fragment amplification were achieved using the method’s PCR amplification thermal cycling program.
-
bioRxiv - Molecular Biology 2021Quote: ... 2.5 µL of 10 µM primer mix (515F forward and 806R reverse rRNA gene V4 primers with Illumina MiSeq adaptors), and 30 ng of sample DNA ...
-
bioRxiv - Immunology 2021Quote: ... and amplified for 12 cycles using the SI-PCR forward primer (10x Genomics) and a Nextera i7 reverse primer (Illumina). For the HTO-containing fraction ...
-
bioRxiv - Systems Biology 2019Quote: ... Resulting moieties were characterized by Sanger DNA sequencing using pMOD forward and reverse primers according to the manufacturer’s protocol (EZ-Tn5, epicentre-Illumina, #TNP10622). Each fragment was then subcloned into a specifically designed SNAP-Tag in vitro expression vector ...
-
bioRxiv - Neuroscience 2020Quote: ... In our study these NGS primer pairs consisted of eight different forward and 12 different reverse primers (based on Illumina adapters [N/S/E]501-[N/S/E]508 and N701-N712) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and amplified for 12 cycles using the SI-PCR forward primer (10x Genomics) and a Nextera i7 reverse primer (Illumina). For the HTO-containing fraction ...
-
bioRxiv - Cell Biology 2022Quote: The iROND samples and embryonic RNA samples were reverse transcribed into cDNA libraries using the TruSeqTM RNA Sample Preparation Kit (Illumina). RNA sequencing was performed with an Illumina HiSeq™ 3000 or HiSeq X Ten platform ...
-
bioRxiv - Microbiology 2019Quote: The 2nd round barcoded PCR was performed by using sixteen forward and twenty-four reverse barcoded primers obtained from Illumina MiSeq protocols (S2 Table) ...
-
bioRxiv - Genetics 2019Quote: ... mRNA was isolated from the DNase-treated total RNA using oligo(dT) and cDNA was synthesized by reverse transcription using TruSeq RNA Library Prep Kit v2 (Illumina). The samples were subsequently end-repaired ...
-
bioRxiv - Genomics 2019Quote: ... Total RNA (150-300 ng) was poly(A) selected and reverse transcribed using a TruSeq Stranded mRNA Library Preparation Kit (Illumina). An 8-base molecular barcode was added to allow for multiplexing and ...
-
bioRxiv - Neuroscience 2022Quote: ... was used to process cell lysates to reverse transcription and library preparation was performed using the Nextera DNA Sample Preparation kit (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... Pooled libraries were sequenced with 25nt in the forward read and 55nt and 150nt in the reverse read on NextSeq and MiSeq (Illumina), respectively.
-
bioRxiv - Plant Biology 2022Quote: ... The second-round PCR was performed using primer pairs with 16 unique indices: D501-D508 and A501-A508 (forward) and D701-D712 and A701-A712 (reverse) (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’) and Reverse Library primers (5’CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTT CCGATC3’, where NNNNNN denotes the barcodes, e.g. Index1 is CGTGAT for Illumina sequencing). Three rounds of agarose gel purification were performed to purify the fragments of 200~650 bp using QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Physiology 2022Quote: ... Total RNA (150–300 ng) was poly(A) selected for reverse transcription using a TruSeq Stranded mRNA Library Preparation Kit (Illumina). Multiplexing was conducted by ligating an 8-base molecular barcode to sequences before 15 cycles of PCR amplification and HiSeq 2500 (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... The fragmented and rRNA-depleted RNA was reverse transcribed to create first strand cDNA using Illumina TruSeq Stranded mRNA Library prep kit (Illumina) followed by second strand cDNA synthesis which incorporates dUTP to quench the second strand during amplification ...
-
bioRxiv - Cell Biology 2023Quote: ... with forward primers designed with a TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG overhang and reverse primers with a GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG overhang encoding adaptors for Nextera XT Indexing (Illumina). Primers are listed in Supplementary Table 5 ...
-
bioRxiv - Genetics 2023Quote: ... Samples were sequenced using 75 bp paired-end sequencing (reverse stranded) on a NovaSeq 6000 system (S4 flow cell, Xp workflow; Illumina).
-
bioRxiv - Molecular Biology 2024Quote: ... QHR-4C libraries were constructed with specific primer pairs (forward primers containing Illumina P5 with sequences near a specific viewpoint and reverse primers containing Illumina P7 with an index and sequences matching the adapter ...
-
bioRxiv - Molecular Biology 2021Quote: ... ribosomal RNAs were removed by a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, RZG1224). Then ...
-
bioRxiv - Genomics 2020Quote: ... microRNA expression profiling was performed using the human v2.0 microRNA Expression BeadChip (Illumina, Inc., San Diego, Calif) with 1146 microRNAs covering 97% of the miRBase 12.0 database according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2020Quote: ... Total RNA was depleted from ribosomal RNA using Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat, Illumina) followed by cDNA library preparation as described below.
-
bioRxiv - Neuroscience 2022Quote: ... All samples were depleted of ribosomal RNA using the Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina) (replicates 1-3 and cycloheximide treated ...
-
bioRxiv - Genetics 2022Quote: ... Libraries were prepared using the Agilent SureSelect XT Human All Exon + UTR (v8) kit followed by Illumina NovaSeq 6000 150 cycle paired end sequencing ...
-
bioRxiv - Molecular Biology 2019Quote: ... mRNA expression levels were extracted from microarray analyses performed on a Human HT-12-v4 BeadChip (Illumina) after labeling (Ambion ...
-
bioRxiv - Microbiology 2021Quote: ... Host ribosomal depletion was performed using a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina). Paired-end transcriptome sequencing was generated on the HiSeq2500 platform (Illumina).
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... and gene expression levels were determined using Illumina Human WG6 Expression BeadChip Version 3 arrays (Illumina Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA samples were treated with a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) and used for RNA-Seq library preparation using an Illumina TruSeq Stranded Total RNA Library Prep Kit (Illumina ...
-
bioRxiv - Neuroscience 2021Quote: ... then cDNA libraries were reverse-transcribed from 200□ng of extracted RNA using TruSeq Stranded Total RNA LT (Illumina® – USA), according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The forward and reverse primers were designed to contain an Illumina® overhang adapter sequence (Illumina®; San Diego, CA, USA) in order to anneal them to primers containing the Illumina® adaptors plus the 8 bp identifier indices ...
-
bioRxiv - Immunology 2019Quote: ... CC (third part, forward primer linker) AGMGTTYGATYMTGGCTCAG (fourth part, forward primer) and 338R CAAGCAGAAGACGGCATACGAGAT (first part, reverse complement of 3′ Illumina adaptor) ACGAGACTGATT (second part ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Plant Biology 2023Quote: The prediction of protein-coding potential for transcripts generated from Illumina and SMRT data was conducted by integrating CPC2 v0.1 ...