Labshake search
Citations for Illumina :
251 - 300 of 2324 citations for Ethyl 4 acetyl 1 cyclopropyl 2 5 dimethyl 1H pyrrole 3 carboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... and base calling using the Real-Time Analysis 3 software (Illumina). Demultiplexing and fastq file generation were performed using bcl2fastq v2.20.0.422 software (Illumina) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... DNA solutions of approximately ≥5 ng μL−1 were subjected to the tagmentation reaction using the Nextera DNA Flex Library Prep Kit (Illumina, San Diego, CA) was used at 1/40 scale of the provided protocol ...
-
bioRxiv - Genomics 2023Quote: ... The resulting sequencing libraries were sequenced using the MiSeq system (Illumina v.2 kit, 2 × 150 bp).
-
bioRxiv - Microbiology 2021Quote: ... with 5% (v/v) 20 pM PhiX (Illumina), using 150 cycle v3 cartridges ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2023Quote: ... In each sequencing run 5% of PhiX (Illumina) was included as an internal control ...
-
bioRxiv - Cell Biology 2024Quote: ... spiked in with 5% PhiX Control v3 (Illumina) and sequenced on an Illumina Novaseq 6000 at a depth of ∼50,000 reads/cell with dual index ...
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Physiology 2024Quote: ... sequencing was performed on a NextSeq instrument (2×75bp 2×10) according to the manufacturer instructions (Illumina Inc.) Reads were trimmed and ribosomal RNA reads were removed ...
-
bioRxiv - Molecular Biology 2020Quote: ... was performed using the SureCell WTA 3’ library prep kit (Illumina, 20014279) according to manufacturer’s instructions with minor modifications ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... using 300-cycle kit (v.3, Illumina, Inc., San Diego, CA, USA) to obtain 150 bp paired-end reads.
-
bioRxiv - Neuroscience 2021Quote: ... 3′ gene expression libraries were dual-index sequenced using NextSeq 150bp (Illumina) flow cells by the Duke Center for Genomic and Computational Biology Core Facility.
-
bioRxiv - Cell Biology 2021Quote: ... The final constructed 3’- biased single cell libraries were sequenced by Illumina Nextseq500 machine ...
-
bioRxiv - Immunology 2022Quote: ... and mixed with 3 μl of Illumina TDE1 Tn5 transposase (Illumina, 15027916). Transposition was performed by incubating the prepared reactions on a C1000 Touch thermal cycler with 96–Deep Well Reaction Module (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... or matched the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Microbiology 2023Quote: ... or matching the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Genetics 2023Quote: ... The final constructed 3’-biased single cell libraries were sequenced by Illumina Novaseq6000 machine ...
-
bioRxiv - Developmental Biology 2023Quote: ... distributed over 3 lanes of a HiSeq 2500 with v4 chemistry (Illumina). Sequencing was performed by the Next Generation Sequencing Facility at Vienna BioCenter Core Facilities (VBCF) ...
-
bioRxiv - Immunology 2024Quote: ... and the SureCellTM WTA 3’ Library Prep Kit (Illumina, San Diego, CA). Magnetically enriched NK cells from malaria-naïve subjects were treated with cytokines IL-15 ...
-
bioRxiv - Plant Biology 2024Quote: ... The 3’mRNA-sequencing was performed in a NovaSeq X (Illumina Platform) by Seqplexing (Paterna ...
-
bioRxiv - Cancer Biology 2020Quote: ... and loaded at 4 nM into the MiSeq sequencer (Illumina) v3 chemistry kit spiked with 10% PhiX genome ...
-
bioRxiv - Immunology 2023Quote: ... or the NovaSeq XP 4-Lane Kit v1.5 (Illumina, 20043131).
-
bioRxiv - Systems Biology 2021Quote: ... S4 reagent cartridge (2×100 bp) (Illumina).
-
bioRxiv - Neuroscience 2020Quote: ... ADNI GO/2 participants (Illumina HumanOmniExpress BeadChip), and ADNI3 participants (Illumina Omni 2.5M ...
-
bioRxiv - Microbiology 2020Quote: ... and sequencing (2 × 150 bp, Illumina HiSeq) were performed by Genewiz (South Plainfield ...
-
bioRxiv - Microbiology 2022Quote: ... 2 (Illumina, catalog No. MS-102-2003) by the University of Michigan Microbial Systems Molecular Biology Laboratory as described previously (14) ...
-
bioRxiv - Microbiology 2021Quote: ... 2) merged triplicates for DC3000 + (Illumina only), 3 ...
-
bioRxiv - Microbiology 2022Quote: ... generating 2 × 300bp paired-end reads (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... and sequenced on 2×150 Miseq (Illumina). Clonal abundances were estimated using a pipeline adapted from 110 ...
-
bioRxiv - Molecular Biology 2023Quote: ... or SMART-Seq™ 2 (Illumina, 20040532), followed by NovaSeq (RIP-seq experiments from Figs ...
-
bioRxiv - Immunology 2023Quote: ... and HiSeq2500 V2 2×150bp (Illumina®) protocols at the “Institut du Cerveau” (ICM ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 2.5 µl of each Nextera Index 1 (N7XX) and Nextera Index 2 (N5XX) primers from a Nextera DNA Sample Preparation Index Kit (Illumina, FC-121-1011). PCR was performed according to the following protocol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 12.5 pmol each of the following Illumina primers: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG ATCT and 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCT (the underlined parts will hybridize to the two Illumina flowcell oligos). Temperature cycling consisted of 72 ◻C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Illumina sequencing libraries were generated for 5 αHHβHH mice and 5 αLLβHL mice using TruSeq RNA Sample Preparation Kit v2 (Illumina, San Diego, CA, USA) and sequenced on an Illumina HiSeq2500 platform ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl water) with 2.5 µl transposase (Illumina 20034197) for 30 min at 37 °C with shaking at 1000 r.p.m ...
-
bioRxiv - Neuroscience 2020Quote: ... An additional 5 samples were sequenced on MiSeq (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... spiked with 5% PhiX pre-made library from Illumina and loaded on a Miseq v3 kit (Illumina Inc. ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl PPC (Illumina Nextera DNA Sample Preparation Kit) and 20 μl DNA ...
-
bioRxiv - Immunology 2022Quote: ... mixed with 5% PhiX and sequenced on MiSeq (Illumina) using MiSeq V3 2 × 300 cycle kit (Illumina).
-
bioRxiv - Genomics 2023Quote: ... 5 µL Tn5 transposase (Illumina Cat FC-121-1030) and 22,5 µL nuclease-free H2O and incubated at 37 °C for 30 mins ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% PhiX control (Illumina, San Diego, CA, USA) along with positive (DNA sample extracted from the healthy gut ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 µM RT Primer (RTP, TruSeq kit; Illumina) was then performed according to the manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2021Quote: ... 10 ng of template DNA and index primer 1 (N7xx) and index primer 2 (N5xx) of Nextera XT Index Kit v2 Set A (Illumina, San Diego, CA, USA) according to the manufacturer’s instruction ...
-
bioRxiv - Physiology 2020Quote: ... RNA-seq libraries were sequenced using paired-end reads (50-nt read 1 and 25-nt read 2) on a NextSeq 500 instrument (Illumina, San Diego, CA, USA). Obtained reads were mapped to the mouse GRCm38.p6 genome using STAR (version 2.7.3a) ...
-
bioRxiv - Genomics 2022Quote: ... 2 μg of Rohu-1 genomic DNA was used with an Illumina TruSeq DNA PCR-free Library Prep Kit (Illumina, San Diego, CA, USA) to create an Illumina sequencing library ...
-
bioRxiv - Cell Biology 2024Quote: ... 8 bases for index 1 and 8 bases for index 2) on NextSeq 500 using the NextSeq 500 High Output Kit 75-cycles (Illumina, Cat# FC-404-1005). Flow lanes were loaded at 1.8pM ...
-
bioRxiv - Cell Biology 2024Quote: ... 8 bases for index 1 and 8 bases for index 2) on NextSeq 500 using the NextSeq 500 High Output Kit 75-cycles (Illumina, Cat# FC-404-1005). Flow lanes were loaded at 1.8pM ...
-
bioRxiv - Bioengineering 2023Quote: ... Sequencing was performed in paired-end mode with HighOutput flow cell (read 1: 28 cycles and read 2: 90 cycles) and a NextSeq 550 sequencer (Illumina, San Diego, CA, USA) at the Transcriptome Core Facility of the Institute in Regenerative Medicine and Biotherapy ...
-
bioRxiv - Genetics 2024Quote: ... which uses proximity extension assay technology coupled to a readout methodology based on next generation sequencing (Illumina NovaSeq 6000, NextSeq 550, and NextSeq 2000; all manufactured by Illumina; appendix 1 p 2), to quantify protein targets ...