Labshake search
Citations for Illumina :
251 - 300 of 8948 citations for DHEA S ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... with six hundred pg cDNA from each plate of cells used in a modified Nextera XT (Illumina) library preparation with 5 μM P5NEXTPT5 primer 42 ...
-
bioRxiv - Genomics 2020Quote: ... Next-Generation Sequencing were carried out using MiSeq Reagent Kit v3 or MiSeq Reagent Kit v2 Micro or Miseq reagent Kit v2 Nano in Miseq system (Illumina Inc, USA) or using NovaSeq 6000 SP Reagent Kit (Illumina Inc ...
-
bioRxiv - Molecular Biology 2021Quote: ... libraries from amplicons 1–4 were mixed with 5% PhiX DNA control library (Illumina) and sequenced ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1.25 µL each of i5 and i7 indexing primers (Illumina, diluted 1:5). The samples were indexed with the following PCR cycles ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Diluted libraries were spiked with 5% Phi-X control (Illumina, San Diego, CA, USA) and sequenced using the Illumina MiSeq (Illumina Inc. ...
-
bioRxiv - Molecular Biology 2022Quote: ATAC-seq was conducted on 5×104 live cells using Nextera Tn5 transposase (Illumina) as previously described (Buenrostro et al. ...
-
bioRxiv - Immunology 2022Quote: ... 5’ expression library was sequenced with NovaSeq 6000 S1 (100 cycles) (Illumina, cat. 20012865) and the V(D)J library was sequenced with NextSeq 500/550 Mid Output Kit v2.5 (300 Cycles ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3,000 U of Quick ligase and 5 nM of annealed adaptor (Illumina truncated adaptor) in a volume of 50 μl and incubated at 25°C for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3,000 units of Quick ligase and 5 nM of annealed adaptor (Illumina truncated adaptor) in a volume of 50 µl and incubated at 25°C for 20 min ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 µL of the Illumina PCR Primer Cocktail (PPC, Illumina FC-121-1030). PCR conditions were as follows ...
-
bioRxiv - Genetics 2020Quote: ... Pooled and denatured library (8 pM) containing 5% volume of PhiX (control library; Illumina) was sequenced using the Illumina MiSeq system with MiSeq Reagent Kit V3 (300-bp paired-end reads ...
-
bioRxiv - Genomics 2021Quote: ... then 4 pM of the pooled library with 5% PhiX v3 control (Illumina, USA) was loaded onto an Illumina MiSeq instrument and sequenced using MiSeq V3 chemistry ...
-
bioRxiv - Cancer Biology 2023Quote: ... Library amplification was performed using 5 μL Nextera XT i7 forward index primer (Illumina) and 5 μL custom i5 index primers (2 μM ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... with the « NEBNext® Ultra™ II DNA Library Prep Kit » kit (Illumina®). Paired-end sequencing was performed in on a HiSeq1500 (Illumina® ...
-
bioRxiv - Microbiology 2019Quote: ... machine with the NextSeq® 500 Mid Output Kit v2 kit (150 cycles) (Illumina), to generate read of 150 bp.
-
bioRxiv - Systems Biology 2023Quote: ... with a 300 bp paired-end reads sequencing kit (MiSeq Reagent Kit v3; Illumina). The raw data from the MiSeq instrument in the gz compressed FASTQ format were analyzed with several bioinformatics tools in the Linux operating system ...
-
bioRxiv - Microbiology 2023Quote: ... using the Illumina DNA Prep kit and unique dual indexes (Illumina Nextera Index kit) at 1:4 scale reaction volume ...
-
bioRxiv - Molecular Biology 2021Quote: ... (M) Tagmentation kit (Illumina, 20018705), with 6 cycles of amplification ...
-
bioRxiv - Genomics 2019Quote: ... and Mate-pair Kit (Illumina), respectively ...
-
bioRxiv - Genomics 2020Quote: ... 500 cycle kit (Illumina, UK) at an 8 pM loading concentration with a 10 % PhiX spike-in ...
-
bioRxiv - Microbiology 2020Quote: ... and NexternaRTM Index Kit (Illumina). All cultured isolates (n=43 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... library preparation (Illumina TruSeq kit), and sequencing (Illumina Hi-Seq ...
-
bioRxiv - Physiology 2022Quote: TruSeq mRNA library kit (Illumina) was used to prepare the mRNA library following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... using Swiftbio kit from Illumina. In brief ...
-
bioRxiv - Molecular Biology 2022Quote: TruSeq Stranded mRNA kit (Illumina) was used for library preparation from total RNA according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: Nextera XT V2 kit (Illumina) sequencing libraries were prepared using 1.5ng of amplified cDNA as per manufacturer’s instructions and sequenced on a 2×150 bp-paired end Illumina MiSeq run ...
-
bioRxiv - Microbiology 2021Quote: ... TruSeq Stranded mRNA kit (Illumina) was used for subsequent steps of cDNA strand synthesis ...
-
bioRxiv - Microbiology 2020Quote: ... The Nextera XT kit (Illumina) was used for library preparation and sequencing was performed using a MiSeq v2 cartridge on a MiSeq sequencer (Illumina) ...
-
bioRxiv - Immunology 2022Quote: ... and Nextera Index Kit (Illumina) primers followed by reverse phase 0.65 x SPRI beads purification and a QIAquick Spin Column (QIAGEN ...
-
bioRxiv - Molecular Biology 2022Quote: ... (M) Tagmentation kit (Illumina, 20018705), with 6 cycles of amplification ...
-
bioRxiv - Microbiology 2022Quote: ... Kapa Library Quant kit (Illumina) and Universal qPCR mix (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... the RiboZero Bacteria Kit (Illumina) was used as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... (M) Tagmentation Kit (Illumina, Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... MiSeq Reagents Kit v3 (Illumina) were used according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 75-cycle kits (Illumina #20024906).
-
bioRxiv - Genomics 2023Quote: ... The Nextera HT kit (Illumina) was used to convert cDNA libraries into sequencing libraries with the addition of a UMI-specific primer to amplify the cDNA ends containing molecular barcodes as described in the Smart-seq3 protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... 100 cycles kit (Illumina, USA). The output was ∼ 25 million single end- 120 bp reads per sample.
-
bioRxiv - Evolutionary Biology 2023Quote: ... the Nextera XT kit (Illumina) was used in a paired-end (2×300 bp ...
-
bioRxiv - Microbiology 2023Quote: ... using the RiboZERO Kit (Illumina), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 300 cycle reagent Kit (Illumina) in a paired-end fashion (150 × 2).
-
bioRxiv - Genomics 2023Quote: ... using NovaSeq Reagent Kits (Illumina) and the SBS (Sequence By Synthesis ...
-
bioRxiv - Microbiology 2024Quote: ... (M) Tagmentation Kit (Illumina Co.), and sequencing was run with the MiSeq Reagent Kit v3 (2 × 300 bp) ...
-
bioRxiv - Microbiology 2024Quote: ... The Nextera XP kit (Illumina) was used to prepare the sequencing library for sequencing on the HiSeq 2500 and NextSeq 1000 instruments (Illumina) ...
-
bioRxiv - Microbiology 2024Quote: ... Ribo-Zero Plus Kit (Illumina) was employed for host ribosomal RNA depletion ...
-
bioRxiv - Genetics 2020Quote: ... Plates were immediately transferred to ice post-incubation and 12 μL of PCR mix (7.5 μL NPM [Illumina Inc ...
-
bioRxiv - Cancer Biology 2022Quote: ... Sequencing libraries from 384-well plates Libraries were sequenced on the NextSeq or NovaSeq 6000 Sequencing System (Illumina) using 2×100 bp paired-end reads and 2×12 bp index reads ...
-
bioRxiv - Molecular Biology 2022Quote: ... The libraries of each plate were pooled separately and sequenced on the HiSeq 2000 (Illumina, San Diego, CA) using a single-end 100 bp technology.
-
bioRxiv - Neuroscience 2023Quote: ... Libraries from up to twelve 96-well plates were sequenced on one MiSeq run (Illumina, San Diego, CA) with paired-end 300 bp sequencing reads (Illumina ...