Labshake search
Citations for Illumina :
251 - 300 of 2377 citations for 7 CHLORO 2H PYRIDO 3 2 B 1 4 OXAZIN 3 4H ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The transposon-specific primer was designed to include (from 5’ to 3’): (i) the “P5” or “P7” flow-cell annealing sequence (Illumina), (ii ...
-
bioRxiv - Genomics 2023Quote: ... Micro-C libraries (at least 3 per each biological replicate) that passed QC criteria were pooled and paired-end sequenced on a NovaSeq6000 platform (Illumina) to >600 million read pairs per replicate ...
-
bioRxiv - Immunology 2023Quote: ... Single-cell RNA libraries were prepared according to the 10x Genomics Chromium Single Cell 3′ Reagent Kits v2 User Guide and sequenced (paired-end) on a HiSeq 4000 (Illumina).
-
bioRxiv - Evolutionary Biology 2023Quote: ... 3) DNA Sequencing and Genomics Laboratory (BIDGEN): Libraries were prepared using the Nextera™ DNA Flex Library Preparation Kit (Illumina) and sequenced on a NovaSeq6000 to generate 2 x 150 bp reads ...
-
bioRxiv - Genomics 2024Quote: ... 4.5 µl of sample were used to generate single cell RNA-Seq libraries by following the Illumina Bio-Rad SureCell WTA 3’ Library Prep Guide (Illumina, San Diego CA and Bio-Rad ...
-
bioRxiv - Genomics 2024Quote: ... was used for a tagmentation reaction that included 3 µL of 2X TMP buffer and 0.5 µL of Transposome (BLT; CAT # 20015880, Illumina Inc.), incubated in a thermocycler at 53 ℃ for 30 minutes with the lid set at 80 ℃ ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... RNA libraries were prepared using QuantSeq 3’-mRNA Library Prep Kit (Lexogen) and RNA-seq was performed with the NovaSeq 6000 (Illumina).
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Lexogen) and samples were sequenced on the HiSeq4000 (Illumina) in single read mode at the Genomics Core (KU Leuven) ...
-
bioRxiv - Pathology 2024Quote: ... The cDNA libraries were prepared using a Chromium Single Cell 3’ V3 kit (10X Genomics, USA) according to the manufacturer’s instructions and then sequenced on a NovaSeq6000 (Illumina, USA). Raw sequencing reads were aligned to the mm10 (GENCODE vM23/Ensembl 98 ...
-
bioRxiv - Microbiology 2021Quote: ... Each pool of V4-V5 16S rRNA amplicons was sequenced (2×300nt paired end) on one lane of a MiSeq V2 sequencer (Illumina, San Diego, CA) at the Carver Biotechnology Center of the University of Illinois ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... one RNA pool of 5 livers from each treatment and sex were independently subjected to sequencing (Illumina Novaseq 6000 paired-end (2×150)) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Samples were 2 × 150 bp paired-end sequenced on one lane each of a HiSeq X Ten instrument (Illumina, Inc., San Diego, CA). Samples for Luke and Nababiep were prepared by HudsonAlpha Institute for Biotechnology (Huntsville ...
-
bioRxiv - Cell Biology 2020Quote: ... an oligonucleotide containing the Illumina P7 adaptor sequence was ligated to the 3’ end of the single stranded LAM PCR fragments using Circligase (Epicentre/Illumina, #CL9025K). A P5 adaptor was added by PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... Sequencing libraries (1.3 nM) were chemically denatured and applied to an Illumina NovaSeq flow cell using the NovaSeq XP chemistry workflow (Illumina-20021664). Following transfer of the flowcell to an Illumina NovaSeq instrument ...
-
bioRxiv - Neuroscience 2020Quote: ... The cell solutions were immediately transferred to ice and transported to the Wellcome Trust Centre for Human Genetics (WTCHG) for scRNAseq via 10x genomics chromium (10x genomics, US) (Single Cell 3’ v3) and Illumina hiseq 4000 (Illumina, US). This approach achieved 66-72K mean reads per cell and a sequencing depth of 53-55% per cell before filtering.
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was extracted and sequence reads (100 bp paired-end) were generated with Illumina TruSeq high output version 3 chemistry on a HiSeq 2500 (Illumina, Inc.) at NRC-Plant Biotechnology Institute (NRC-PBI) ...
-
bioRxiv - Cancer Biology 2020Quote: ... TN5 tagmentation and library amplification realized 3’end fragments by Nextera XT DNA Sample Preparation Kit (Illumina, Cat#FC-131-1024) according to the manufacturer’s instructions while P5_TSO and Nextera_N7xx took the place of the custom primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... 500 ng of total RNA were used as input for QuantSeq (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina; Lexogen) following the autoQuantSeq automated workflow ...
-
bioRxiv - Immunology 2019Quote: ... CC (third part, forward primer linker) AGMGTTYGATYMTGGCTCAG (fourth part, forward primer) and 338R CAAGCAGAAGACGGCATACGAGAT (first part, reverse complement of 3′ Illumina adaptor) ACGAGACTGATT (second part ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were processed according to the standard 10x Chromium 3’ workflow and pooled before sequencing over two lanes (Illumina HiSeq 4000).
-
bioRxiv - Cancer Biology 2019Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters from TruSeq™ Stranded Total RNA Sample Preparation Kit with Ribo-Zero Gold (Illumina) were ligated.
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng alkylated RNA was used and prepared with a commercially available kit (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina, Lexogen). Sequencing was performed on an Illumina NovaSeq SP platform in 100bp-single-read mode.
-
bioRxiv - Genomics 2021Quote: ... and 1µM Dexamethasone or 0.1% ethanol for 3 hours. Transposition was performed using the OmniATAC protocol (Corces et al. 2017) and the tagment DNA TDE1 enzyme (Illumina, 20034197). DNA was purified using the MinElute PCR purification kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: The input samples were submitted to the Washington University Genome Technology Access Center to obtain and sequence the cDNA libraries (10XGenomics, 3’v3.1; Illumina NovaSeq S4) according to established protocols ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 x 105 mESCs and 5 x 104 S2 cells were resuspended in Tagment DNA Buffer and treated with 3 µL TDE1 Tagment DNA Enzyme (Illumina 20034197). After thorough mixing ...
-
bioRxiv - Genomics 2023Quote: For all tandem repeat identification and quantification we used DNA sequences from 2,504 individuals from the Phase 3 of the 1,000 Genomes Project (∼30x coverage Illumina short-read data) (Byrska-Bishop et al ...
-
bioRxiv - Genomics 2023Quote: ... 200ng alkylated RNA were used as input for generating 3’-end mRNA sequencing libraries using a commercially available kit (QuantSeq 3ʹ mRNA-Seq Library Prep Kit FWD for Illumina, Lexogen).
-
bioRxiv - Immunology 2024Quote: ... 2024) using the command CreateSeuratObject with the following parameters: min.cells = 3 and either min.features = 200 (for Illumina reads from MBC gate) or min.features = 100 (for the Oxford Nanopore reads from the ASC gate) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Then the scRNA-seq libraries were constructed by using the Chromium Next GEM Single Cell 3’ Reagent Kits v3 (10X Genomics, USA) and sequenced by using the sequencer Novaseq6000 (Illumina, USA). All procedures were following the manufacturer’s protocol.
-
bioRxiv - Microbiology 2022Quote: ... Australia on one MiSeq V3 system (Illumina) with 2×300bp paired-end reads.
-
bioRxiv - Microbiology 2023Quote: ... Australia on one MiSeq V3 system (Illumina) with 2×300bp paired-end reads.
-
bioRxiv - Immunology 2020Quote: ... Libraries were sequenced on the iSeq (cases 1 - 6 and controls) or NovaSeq 6000 (case 7 and controls) (Illumina) using 150nt paired-end reads.
-
bioRxiv - Molecular Biology 2020Quote: ... Small RNA-seq libraries for 2–4 biological samples were sequenced together using a NextSeq 500 (Illumina) to obtain 75 nt ...
-
bioRxiv - Genomics 2021Quote: ... We used one of the cohorts for our main analyses (AEMS450K1, Athero-Express Methylation Study Illumina 450K 1) and the other smaller cohort for replicating the effect size of methylation sex differences (AEMS450K2 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... we combined 3 μl of each sample (approx 2.24 ng) with a small quantity of a Nextera™ tagment DNA enzyme (Illumina catalogue #15027865). To decrease costs ...
-
bioRxiv - Microbiology 2021Quote: ... The libraries were sequenced using an Illumina MiSeq with MiSeq Reagent Kit v.3 (2x 300 bp, Illumina, San Diego, CA, USA) according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... The quantitative 3-step real-time PCR was performed by the Eco Real-Time PCR system (Illumina Inc., San Diego CA, USA) and CFX Connect (Bio-Rad Laboratories AG ...
-
bioRxiv - Genetics 2019Quote: ... with the European individuals from the 1000G phase 3 reference panel and from the Human Genome Diversity Panel data30 (HGDP, Illumina HuHap 650k), to generate four genome-wide SNP datasets analyzed independently.
-
bioRxiv - Cancer Biology 2021Quote: ... RNA-seq libraries were constructed using a QuantSeq 3’mRNA-Seq Library Prep Kit (LEXOGEN, Vienna, Austria) and sequenced with the NextSeq500 (Illumina, CA, USA) to generate a minimum of two million single-end 75-bp reads ...
-
bioRxiv - Genomics 2021Quote: ... and Reverse primer (5’-GTC TCG TGG GCT CGG AGA TGT GTA TAA GAG ACA GGA CTA CHV GGG TAT CTA ATC C-3’) with Illumina sequencing adaptors (Illumina, California, USA). The purified PCR products were then subjected to a multiplexing process using Nextera XT Index kit (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... all of the ChIP DNA and 220 ng of input DNA were mixed with 3 units of T4 DNA polymerase (NEBNext® DNA Library Prep Master Mix Set for Illumina, #E6040L) to create blunt ends ...
-
bioRxiv - Genomics 2023Quote: ... WGS of the samples of Batch 3 was commercially performed by Eurofins (Germany) using Genome Sequencer Illumina NovaSeq platform (Illumina, California, USA) (paired-end 150 bp reads).
-
bioRxiv - Synthetic Biology 2024Quote: ... and a reverse primer annealing to the intronic region directly 3’ of the J segment (PCR1 Rev primer with Illumina adapter overhang). PCRs were performed with Q5 High-fidelity DNA polymerase (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... by adding 4 μl of 1× CircLigase II Buffer (Epicentre/Illumina), 2 μl of 50mM of MnCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... puteoserpentis (499ROV/1-4) specimens using short-read (Illumina HiSeq 3000) and long-read (PacBio ...
-
bioRxiv - Genomics 2023Quote: ... coverage and eight additional female genomes (4 Asian and 4 African) at ~30× (1 lane of Illumina Hiseq X Ten) coverage using 10x Linked-Reads at HudsonAlpha Institute of Biotechnology ...
-
bioRxiv - Cancer Biology 2020Quote: ... The libraries were quantitated by qPCR and sequenced on one lane for 101 cycles from one end of the fragments on a NovaSeq 6000 (Illumina) using a NovaSeq SP reagent kit and yielded 400 to 500 million single reads per lane ...
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were pooled and quantified using qPCR and were then sequenced on one S Prime (SP) lane for 101 cycles from one end of the fragments on a NovaSeq 6000 (Illumina). FASTQ files were generated from the raw sequencing runs and demultiplexed with the bcl2fastq v2.20 Conversion Software (Illumina) ...
-
bioRxiv - Genomics 2020Quote: ... two NextSeq and one NovaSeq instrument (all Illumina).
-
bioRxiv - Genomics 2020Quote: ... sequenced on one lane of HiSeq X (Illumina). One of the DNA preps inferred to have HMW DNA was used to prepare a linked reads Chromium library (10x genomics ...