Labshake search
Citations for Illumina :
251 - 300 of 999 citations for 6 1 BROMO ETHYL 4 CHLORO 5 FLUOROPYRIMIDINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and 5-day deligated samples were sequenced (the ligated sample was sequenced on the Illumina Nextseq500 and all others were sequenced on the Illumina Nextseq2000) ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Microbiology 2023Quote: ... all libraries were spiked with 5% PhiX Control v3 (Illumina, Catalog No. FC-110-3001). The NCBI Genbank accession number for the raw sequencing data reported here is PRJNA999749.
-
bioRxiv - Genomics 2023Quote: ... were dual-indexed using differing barcode indexes both for the forward (5’ P5 Illumina adapter) and reverse oligos (3’ P7 Illumina adapter) ...
-
bioRxiv - Genomics 2020Quote: ... denatured and diluted to 4 pM before loading onto the MiSeq flow cell (Illumina Inc., United States). According to Illumina protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Nuclei were then pelleted (1,000xg, 10min, 4°C) and transposed in 2.5µl Tn5 (Nextera Tn5 transposase, Illumina), 12.5µl TD reaction buffer and 10.5µl water for 40min at 37°C with rotation ...
-
bioRxiv - Genomics 2020Quote: ... The library was sequenced on 4 lanes of an Illumina HiSeq 1500 (Illumina Inc.; San Diego, CA), generating 450,132,548 reads which were subsequently trimmed to remove adapters and filtered for length and quality using FASTX-Toolkit v0.0.14 (available from http://hannonlab.cshl.edu/fastx_toolkit/) ...
-
bioRxiv - Genomics 2019Quote: ... After normalization the libraries were sequenced in 4-plex on HiSeq 2000 or HiSeq 2500 machines (Illumina) in paired-end 2 × 100 bp.
-
bioRxiv - Developmental Biology 2019Quote: The paired-end reads for each sample run across 4 lanes of the flow cell (20022408, Illumina) were concatenated to obtain one forward and one reverse fastq.gz files each ...
-
bioRxiv - Molecular Biology 2019Quote: ... (4) The amplified fragments were sequenced on the Illumina HiSeq™ 4000 platform (Illumina, San Diego, USA) by Gene Denovo Biotechnology Co ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were diluted to 4 nM and sequenced on a NextSeq 500 Sequencing System (Illumina, California, USA) using NextSeq 500/550 High Output Kit v2 (150 cycles ...
-
bioRxiv - Genomics 2021Quote: ... The library pool was sequenced on all 4 lanes of an NovaSeq 6000 S4 flow cell (Illumina) for 150 bp paired end reads ...
-
bioRxiv - Molecular Biology 2020Quote: ... Small RNA-seq libraries for 2–4 biological samples were sequenced together using a NextSeq 500 (Illumina) to obtain 75 nt ...
-
bioRxiv - Immunology 2023Quote: ... We observed less than 4% barcode swapping between the two barcodes (more than 96% of the Illumina sequencing reads contained correct endodomain and barcode pairs) ...
-
bioRxiv - Immunology 2021Quote: ... GEX libraries were pooled and sequenced at a depth of approximately 540,000,000 reads per sample in a single S4 flow cell and ADT libraries at a depth of approximately 79,000,000 reads per sample in a single lane of an S4 flow cell on a NovaSeq™ 6000 (Illumina, San Diego, CA; Extended Data Table 6)
-
bioRxiv - Developmental Biology 2021Quote: ... and the resulting nuclear pellet was resuspended in 5 µl buffer TD (Illumina, San Diego, CA) and combined with 2.5 µl H2O and 2.5 µl Tn5 transposase (Tagment DNA Enzyme ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μg DNase-treated RNA was used as input for ribosomal depletion using the Epicentre (Illumina) Ribo-Zero ribosomal depletion kit (Cat# SCL24H) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified mRNA 5′ end libraries were multiplexed again and then sequenced on HiSeq 4000 (Illumina) using paired-end (2x 100 cycles ...
-
bioRxiv - Developmental Biology 2022Quote: ... Completed libraries were pooled in an equimolar ratio along with 5% PhilX Control Library V3 (Illumina), denatured and diluted to 2.0pM as per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... parental fish were whole-genome sequenced with 5–10X coverage (Illumina Hiseq platforms, BGI Hong Kong). The genotyping of F1 fish was carried out with the DarTseq technology (Diversity Arrays Technology ...
-
bioRxiv - Developmental Biology 2022Quote: ... and the resulting nuclear pellet was resuspended in 5 µl buffer TD (Illumina, San Diego, CA) and combined with 2.5 µl H2O and 2.5 µl Tn5 transposase (Tagment DNA Enzyme ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Amplicons were calculated for their nano-molarity and diluted to 4 nM (see Illumina 470-2016-007-B) for HTS run on MiSeq sequencer using the Illumina MiSeq Reagent Kit Version 3 (600bp pair-ended) ...
-
bioRxiv - Molecular Biology 2021Quote: ... before being diluted to approximately 4 nM for loading onto an Illumina MiSeq (Illumina, San Diego, CA, USA). An Illumina 500 cycle MiSeq Reagent Kit v2 (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... and 4 samples were combined into RNA-seq runs on the Illumina MiSeq platform (Illumina, San Diego, CA).
-
bioRxiv - Genomics 2021Quote: ... The final libraries at the concentration of 4 nM were sequenced on NextSeq 500 platform (Illumina, CA, USA) using 75 bp paired-end sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μg total RNA per sample were used for the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina) to generate cDNA libraries according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... The additional 71 ASH donors were genotyped separately at 4,327,108 SNPs with the Infinium Omni5-4 v1.2 BeadChip (Illumina, California). We updated SNP identifiers based on Illumina annotation files (https://support.illumina.com/content/dam/illumina-support/documents/downloads/productfiles/humanomni5-4/v1-2/infinium-omni5-4-v1-2-a1-b144-rsids.zip ...
-
bioRxiv - Immunology 2022Quote: ... High-resolution 4-digit HLA typing was performed with the TruSight HLA v2 Sequencing Panel kit from Illumina according to the manufacturer instruction ...
-
bioRxiv - Microbiology 2022Quote: ... Six samples per condition containing 4 μg of total RNA were used for TruSeq mRNA library preparation (Illumina) after being treated with Globin-Zero Gold rRNA Removal Kit (Illumina) ...
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were pooled together and sequenced using 75bp paired-end chemistry across 4 lanes of a Hiseq4000instrument (Illumina) to achieve 10 million reads per sample ...
-
bioRxiv - Genetics 2021Quote: ... We find that even sequencing error rates as high as 5% (50x higher than Illumina sequencer error) have very little effect on clustering quality under most correlation cut-offs ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were sequenced (5’ single end; single-end 75x) using the NextSeq500 high-throughput sequencing system (Illumina) at the Cornell University Biotechnology Resource Center ...
-
A New Gene Set Identifies Senescent Cells and Predicts Senescence-Associated Pathways Across TissuesbioRxiv - Cell Biology 2021Quote: ... and 2-5 cm inferior to the navel.24,38 Sequencing was performed on a HiSeq2000 (Illumina®), fastq files were mapped to the human reference genome hg19 ...
-
bioRxiv - Cell Biology 2021Quote: ... The purified DNA was PCR amplified for 5 cycles using a Nextera DNA Library Index kit (Illumina) and Phusion HF Master Mix (New England BioLabs ...
-
bioRxiv - Microbiology 2020Quote: ... was performed with ~5 million reads / sample in single-end mode on the NextSeq 500 platform (Illumina), using the High Output Kit v2.5 (75 cycles) ...
-
bioRxiv - Microbiology 2021Quote: ... Approximately 5 μg total RNA samples were treated with the Ribo-Zero™ rRNA removal procedure (Illumina) to enrich for mRNA ...
-
bioRxiv - Microbiology 2020Quote: ... cells were lysed in ATAC lysis buffer for 5 min and then transposed with TN5 transposase (Illumina) for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: 5 µg total RNA isolated from Flag elution samples were treated with Yeast RiboZero Gold (Illumina, MRZY1306) according to the manufacturer’s instructions to remove yeast rRNAs from the samples ...
-
bioRxiv - Cancer Biology 2020Quote: ... The 5’GEX libraries were sequenced each of on a separate lane of HiSeq4000 flow cell (Illumina) to target sequencing depth of 50,000 read pairs per sample ...
-
bioRxiv - Immunology 2022Quote: ... cells were lysed in ATAC lysis buffer for 5 minutes and then transposed with TN5 transposase (Illumina) for 30 minutes at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... Approximately 5 μg total RNA samples were treated with the Ribo-Zero™ rRNA removal procedure (Illumina) to enrich for mRNA ...
-
bioRxiv - Plant Biology 2022Quote: ... and 5 mM β-mercaptoethanol) and then subjected the nuclei to a transposition reaction with Tn5 (Illumina). The transposition reaction was performed with 25 μl of 2x DMF (66 mM Tris-acetate pH 7.8 ...
-
bioRxiv - Microbiology 2023Quote: ... Approximately 5 million 75-nt single reads per sample were determined using a NextSeq High Output (Illumina), with >96% of the reads having a Q30 quality.
-
bioRxiv - Cancer Biology 2023Quote: ... Samples that qualified (RIN>5) were prepped using the standard protocol for Illumina Stranded mRNA prep (Illumina). Sequencing was done using the Illumina NextSeq 2000 with paired-end 59 bp × 59 bp reads ...
-
bioRxiv - Molecular Biology 2022Quote: ... or purified chromosomes (2 x 106 pelleted at 10,000g for 10min at 4°C) were resuspended in 50 μl transposase mixture (25 μl Illumina TD buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... 4 nM of this pool were loaded on a high output flowcell and sequenced on a NextSeq500 platform (Illumina) with 2×75nt paired-end chemistry.
-
bioRxiv - Systems Biology 2019Quote: ... We sequenced to a depth of at least 500,000 reads per RNA sequencing library (with a typical depth of around 4 million reads) on a NextSeq500 (Illumina). While we targeted 48 clones and 48 controls for each cell line ...
-
bioRxiv - Immunology 2022Quote: ... Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH as recommended by Illumina. The final library was loaded at a concentration of 8 pM ...
-
bioRxiv - Microbiology 2022Quote: ... Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH as recommended by Illumina. The final library was loaded at a concentration of 8 pM ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries were pooled into a 4 nM solution and sequenced on the Illumina MiSeq platform (Illumina; San Diego; CA) with a target sequencing yield of 500MB-1GB per virome.