Labshake search
Citations for Illumina :
251 - 300 of 2148 citations for 1 Benzyl 4 5 benzyloxy 6 methoxy 1 indanone 2 ylidenyl methylpiperidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μl Tn5 enzyme (Illumina), 0.25 μl 1 % digitonin ...
-
bioRxiv - Genetics 2023Quote: 2×150bp reads from Illumina NovaSeq were obtained for all samples with a minimum depth of 22M reads at Novogene (Beijing ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2) Detection from Illumina RNA-seq data through SL leader sequence trimming(43) ...
-
bioRxiv - Genetics 2023Quote: 2×150bp reads from Illumina NovaSeq were obtained for all samples with a minimum depth of 17 M reads at Novogene (Beijing ...
-
bioRxiv - Microbiology 2021Quote: ... UK). Libraries were prepared from 8 samples (4× T. brucei, 4× T. congolense) using the TruSeq Stranded mRNA kit (Illumina) and 2 × 75 bp paired-end sequencing was carried out using a HiSeq 4000 system (Illumina) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Barcoded libraries of ten samples (4 treated, 4 untreated and two controls) were equimolarly pooled and sequenced on MiSeq (Illumina) using MiSeq v3 150 reagent kit (MS-102-3001 ...
-
bioRxiv - Genomics 2023Quote: ... 4 washes with PR2 buffer (PR2, Illumina MiSeq), and 6 minute incubation at 60°C with shaking followed by 4 washes was performed a total of 3 times ...
-
bioRxiv - Cell Biology 2020Quote: ... Each sample was sequenced in 1 lane of the HiSeq2500 (Illumina) in Rapid Run Mode ...
-
bioRxiv - Immunology 2022Quote: ... Index read 1:8 cycles or on a HiSeq X (Illumina), using a 150 cycle flowcell with the read configuration ...
-
bioRxiv - Developmental Biology 2020Quote: ... or 10 minutes (H3K27ac) with 1 µl of Tn5 transposase (Illumina 15027865 ...
-
bioRxiv - Genetics 2020Quote: ... 1 μL genomic DNA (same lysates as used for Illumina MiSeq); for a total of 11 μL ...
-
bioRxiv - Genetics 2020Quote: ... 1 μL genomic DNA (same lysates as used for Illumina MiSeq); for a total of 25 μL ...
-
bioRxiv - Genetics 2020Quote: ... 1 μL genomic DNA (same lysates as used for Illumina MiSeq); for a total of 20 μL ...
-
bioRxiv - Molecular Biology 2020Quote: ... A library input of 1.4 pM (with 1 % PhiX Control (Illumina)) was sequenced using the NextSeq 500 instrument (Illumina ...
-
bioRxiv - Genetics 2022Quote: ... The library was sequenced using NextSeq500 1 × 75 SE platform (Illumina) in HMS Biopolymers Facility ...
-
bioRxiv - Immunology 2023Quote: ... Library pools were further diluted to 20pM using HT-1 (Illumina) before being diluted to a final loading concentration of 14pM ...
-
bioRxiv - Systems Biology 2024Quote: ... was amplified using the primers SYM_VAR_5.8S2: 5′ (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG)GAATTGCAGAACTCCGTGAACC 3′ and SYM_VAR_REV: 5′ (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG)CGGGTTCWCTTGTYTGACTTCATGC 3′ (50) (Illumina adaptor overhangs underlined). For all samples ...
-
bioRxiv - Biophysics 2021Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl Nextera i5 primer (S5xx, Illumina), and 5 μl of a custom i7 primer mix (0.5 μM i7_BCx + 10 μM i7_primer ...
-
bioRxiv - Biophysics 2022Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Biophysics 2023Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples (GJJ_1J) ...
-
bioRxiv - Biochemistry 2024Quote: ... with 5% phiX (Illumina, FC-110-3001) was loaded to the sequencer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 × 150 bp flow cells (Illumina).
-
bioRxiv - Cancer Biology 2024Quote: ... 2×150 cycle strategy (Illumina Inc.). Paired-end reads were produced with a 100x coverage ...
-
bioRxiv - Biochemistry 2024Quote: ... Round 2 primers (Illumina TruSeq Adapters) were added to each reaction to 400 nM ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2% PhiX (PhiX Control v3, Illumina) was spiked into the sample and 20 µL were added to an Illumina iSeq 100 i1 Reagent v2 cartridge ...
-
bioRxiv - Neuroscience 2023Quote: ... and sequencing (Illumina HiSeq 2 × 150bp) were all performed at GeneWiz ...
-
bioRxiv - Developmental Biology 2020Quote: ... and spr-1(ok2144) strains was performed using a MiSeq instrument (Illumina), following the manufacturer’s recommended protocols (available on the Illumina website) ...
-
bioRxiv - Immunology 2021Quote: ... Library pools were further diluted to 20 pM using HT-1 (Illumina) before being diluted to a final loading concentration of 14 pM ...
-
bioRxiv - Genomics 2020Quote: ... The libraries were 1×75 bp sequenced on a NextSeq500 system (Illumina). QPCR Universal Human Total Reference RNA (UHR ...
-
bioRxiv - Plant Biology 2021Quote: ... using 1 mg of RNA and sequenced on a HiSeq 3000 (Illumina) resulting in a sequence depth of 35 million paired-end reads (2x 150bp) ...
-
bioRxiv - Biophysics 2022Quote: ... to create 1 ml of a 20 pM denatured DNA sample (Illumina). PhiX control library (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... Library pools were further diluted to 20 pM using HT-1 (Illumina), before dilution to a final loading concentration of 16 pM ...
-
bioRxiv - Genomics 2021Quote: ... GSA version 3 with direct-to-consumer booster by Illumina (Fig. 1). This Customized chip is the intersection of commonly used chips ...
-
bioRxiv - Plant Biology 2022Quote: ... prior to 1 × 75 bp high-throughput sequencing by NextSeq 500 (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... The sequencing run was spiked-in with 1-% PhiX library (Illumina, UK) to control for the hardware and software performance of the instrument ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.003 μl Tagmentation DNA Enzyme 1 (TDE1; Illumina DNA sample preparation kit) to the 1μl of diluted cDNA per well ...
-
bioRxiv - Genomics 2024Quote: ... with IDT for Illumina UD Indexes (96x, Plate A, Set 1, Illumina). Library size selection was performed to remove fragments below 180 bp and above 700 bp using AMPure XP beads (Beckman coulter) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Library pool was further diluted to 20 pM using HT-1 (Illumina) before being diluted to a final loading concentration of 12.5 pM ...
-
bioRxiv - Microbiology 2023Quote: ... Sequences of six IncX4 plasmids carrying mcr-1 were extracted from Illumina data and gaps were filled by PCR-based strategy and Sanger sequencing.
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries 1-3 (wild type) were sequenced on a NovaSeq 6000 (Illumina) and the mutant library was sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Cell Biology 2024Quote: ... Tn5 transposase reaction was performed using the Tagment DNA Enzyme 1 (Illumina) at 37 °C for 30 min ...
-
bioRxiv - Microbiology 2024Quote: ... for the leaf sample from location 1 and the NovaSeq6000 platform (Illumina) for the sample from location 2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 sequencing run per replicate) were sequenced on a MiniSeq system (Illumina), using 75 bp single-end sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: ... They were then sequenced with NextSeq 500 1×150 (Illumina, California, USA).
-
bioRxiv - Genetics 2024Quote: ... which is based on the file “MethylationEPIC_v-1-0_B4.csv” from Illumina. The following abbreviations were used ...
-
bioRxiv - Immunology 2022Quote: ... or NovaSeq XP 4-Lane Kit v1.5 (Illumina, 20043131).
-
bioRxiv - Immunology 2022Quote: ... or NovaSeq XP 4-Lane Kit v1.5 (Illumina, 20043131).
-
bioRxiv - Immunology 2022Quote: ... or NovaSeq XP 4-Lane Kit v1.5 (Illumina, 20043131).
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.