Labshake search
Citations for Illumina :
201 - 250 of 9332 citations for Rat Insulin Like 3 INSL3 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... RNA-seq libraries were constructed using a QuantSeq 3’mRNA-Seq Library Prep Kit (LEXOGEN, Vienna, Austria) and sequenced with the NextSeq500 (Illumina, CA, USA) to generate a minimum of two million single-end 75-bp reads ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD for Illumina and UMI Second Strand Synthesis Module for QuantSeq FWD (Illumina, Read 1) from Lexogen (015.96 and 081.96 ...
-
bioRxiv - Microbiology 2021Quote: ... All RNA samples were treated with RiboZero (Human/Mouse/Rat) (Illumina, San Diego, CA) for the depletion of ribosomal RNA ...
-
bioRxiv - Genetics 2020Quote: RNA-seq libraries (TruSeq® Stranded Total RNA Library Prep Human/Mouse/Rat, Illumina) were prepared from 150 ng of previously isolated viral RNA according to the manufacturers’ protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA-seq libraries were generated using Illumina SureCell WTA 3’ Library Prep Kit for the ddSEQ System (6 cartridge version, cat.no. 20014280, Illumina, San Diego, CA, USA). Libraries were assessed for quality ...
-
bioRxiv - Genomics 2020Quote: ... and libraries were constructed by the Lexogen QuantSeq 3’ mRNA-Seq Library Kit FWD (Lexogen, Vienna, Austria).19 All RNA libraries were sequenced by the Illumina HiSeq4000 (Illumina, San Diego, CA). Raw sequencing data were aligned to the reference genome (GRCh37 ...
-
bioRxiv - Genetics 2021Quote: ... Libraries constructed with the Lexogen QuantSeq 3′ mRNA-Seq Library Kit FWD (Lexogen, Greenland, NH) were sequenced on an Illumina NextSeq 500 (Illumina, San Diego, CA) at the Genomics Facility of the Cornell Institute of Biotechnology.
-
bioRxiv - Microbiology 2021Quote: ... Goe13 and lysogens and sequenced with the MiSeq system and reagent kit V.3 (2 x 300 bp) (Illumina, San Diego, CA, USA) and the NovaSeq system (2x 150bp ...
-
bioRxiv - Genomics 2024Quote: ... and an independent validation set (3 Illumina HumanMethylation450K array studies ...
-
bioRxiv - Genomics 2024Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we added four mate pair libraries (3 kb, 5 kb, 7 kb, 8 kb) prepared using a Nextera Mate Pair Library Prep kit (Illumina, San Diego, CA, USA). Each library was sequenced on an Illumina HiSeq 2500 sequencer by Novogene (Sacramento ...
-
bioRxiv - Plant Biology 2022Quote: ... We prepare 12 cDNA libraries (3 individuals □ 2 sampling times (dawn and dusk) □ 2 localities) using the TruSeq RNA-seq library prep kit from Illumina (Illumina, Inc., CA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Sequencing libraries were prepared by transposase-assisted tagmentation and enrichment of 3’end of genes using Nextera XT DNA Library Prep Kit (Illumina, San Diego, CA, USA). The libraries were sequenced on the HiSeq2500 for 25 and 75 cycles paired-end reads ...
-
bioRxiv - Immunology 2024Quote: ... China), using Chromium Single Cell 3’ Reagent Kits v2 (from 10x Genomics, Pleasanton, CA, USA) and NovaSeq 6000 System (Illumina, San Diego, CA, USA) respectively ...
-
bioRxiv - Genomics 2023Quote: ... RNA was extracted from similar pooled-samples (N = 3) using the ZYMO (Irvine, CA, USA) direct-zol miniprep kit (Cat. # R2050) and sequenced using NovaSeq (Illumina, San Diego, CA, USA) paired-end (150 bp ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2024Quote: ... 16S rRNA PCR amplification and next-generation sequencing were performed at MR DNA (www.mrdnalab.com) using primers 515F-Y (5’-GTGCCAGCMGCCGCGGTAA-3’)73 and 806R (5’-GGACTACHVGGTWTCTAAT-3’)74 using Illumina MiSeq (Illumina Corp) 2x300 paired- end reads ...
-
bioRxiv - Biophysics 2021Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Table S1) ...
-
bioRxiv - Genomics 2019Quote: ... to generate ~3 GB data (Illumina, Inc, USA). The total yield of the Number of Paired end was 26,263,128 with the maximum data of 3.78 GB ...
-
bioRxiv - Biophysics 2022Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Supplementary Table 1) ...
-
bioRxiv - Biophysics 2023Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (Supplementary Table 3 ...
-
bioRxiv - Genomics 2024Quote: ... and alternating reverse oligos (3’ P7 Illumina adapter). The demulitplexing primers used for PCR2 are listed in Extended Data Table 4 ...
-
bioRxiv - Immunology 2021Quote: ... Libraries were prepared following 10X Genomics protocols (Chromium Single Cell 3’ Reagent Kits v2 Chemistry) and sequenced on NovaSeq 6000 (Illumina S2 flow cell, paired-end). FASTQ files were processed using cellranger (https://support.10xgenomics.com/single-cell-gene-expression/software/pipelines/latest/what-is-cell-ranger ...
-
bioRxiv - Molecular Biology 2023Quote: ... and each sample was sequenced in 3 different lanes (3 technical replicates per sample) on an Illumina HiSeq platform (Illumina, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Neuroscience 2022Quote: ... For mouse and rat sequencing data the reference genome GRCm38 and Rnor 6.0 provided by Illumina igenomes were used ...
-
bioRxiv - Cell Biology 2024Quote: ... libraries were generated using TruSeq® Stranded Total RNA Library Prep Human/Mouse/Rat (20020597, Illumina). Sequencing reads with 75 bp paired ends were generated on an Illumina HiSeq 2500 platform following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: 16S amplicon sequencing targeting the V3 and V4 variable regions of the 16S rRNA (341F: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 805R: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) was performed on the Illumina MiSeq platform (Illumina, California, USA) according to manufacturer’s guidelines and generated paired-end reads of 300bp in each direction ...
-
bioRxiv - Immunology 2024Quote: ... 3 biological replicates were sequenced with NextsSeq 550 (Illumina). For data analysis ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
bioRxiv - Developmental Biology 2024Quote: ... we prepared n=40 sequencing libraries from 1µg total RNA per sample using Illumina® Stranded mRNA Prep kits with unique 5′ and 3′ index adapter pairs (IDT for Illumina® RNA UD Indexes, Set A). Libraries were PCR amplified for 10 cycles ...
-
bioRxiv - Microbiology 2019Quote: ... and the primers V3F - 5’-CCTACGGGNGGCWGCAG-3’ and V4R – 5’-GACTACHVGGGTATCTAATCC-3’ [28] with the addition of the appropriate Illumina Nextera XT overhang adapter sequences (Illumina, San Diego, CA, USA). Following purification using a magnetic bead capture kit (Ampure ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples that met the Illumina TruSeq Stranded Total RNA (Human/Mouse/Rat) (Illumina Inc., San Diego, CA,USA) sample input guidelines were prepared according to the kits protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3’ end adenylation per the TruSeq protocol (Illumina, Inc.), libraries were constructed using an Apollo 324 automated library system ...
-
bioRxiv - Genomics 2019Quote: ... the sequence 3’ of the indices were bound by Illumina’s Sequencing Primers ...
-
bioRxiv - Developmental Biology 2021Quote: RNA from sorted human and naked mole-rat populations was sequenced at ∼100 million reads on a HiSeq2500v4 (Illumina), the SMARTer® Ultra® Low RNA Kit (Takara ...
-
Naked Mole-Rat Hematopoietic Stem and Progenitors are Highly Quiescent with an Inherent Myeloid BiasbioRxiv - Cell Biology 2021Quote: RNA from sorted human and naked mole-rat populations was sequenced at ∼100 million reads on a HiSeq2500v4 (Illumina), the SMARTer® Ultra® Low RNA Kit (Takara ...
-
Evolutionarily divergent mTOR remodels the translatome to drive rapid wound closure and regenerationbioRxiv - Developmental Biology 2021Quote: ... The libraries were prepared by the Stanford Genomic Services Center per manufacturer’s instructions using the TruSeq Stranded Total RNA Library Prep with Ribo-Zero Gold Human/Mouse/Rat (Illumina) and sequenced (PEx150 ...
-
bioRxiv - Immunology 2023Quote: ... dual-indexed 3’ DGE libraries were prepared using Nextera XT (Illumina) and sequenced to depth on the NovaseqS4 platform with a paired-end read structure (R1 ...
-
bioRxiv - Immunology 2023Quote: ... Sequencing was performed in 3 sequencing unit of NovaSeq 6000 (Illumina) (100-nt-length reads ...
-
The RNA-Binding Protein SAM68 regulates cardiomyocyte differentiation by enhancing Gata4 translationbioRxiv - Molecular Biology 2022Quote: ... rRNA depletion and library preparation was done with the TruSeq stranded total RNA Library prer Human/Mouse/Rat (20020596, Illumina). The sequencing was performed using 2×125bp paired-ends reads on a HiSeq 2500 sequencer with HiSeq v4 chemistry ...
-
bioRxiv - Cancer Biology 2022Quote: ... Libraries were generated from 1 μg of total RNA using a TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat (48 Samples) (Illumina) per manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... rRNA was removed and total RNA library was prepared with TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat (Illumina) and sequenced by Illumina platform HiSeq2500 Paired-end 125 bp.
-
bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ...