Labshake search
Citations for Illumina :
201 - 250 of 1259 citations for Parvalbumin PVALB cDNA ORF Clone Mouse N His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... cDNA libraries were sequenced on the NovaSeq 6000 platform (Illumina) with 2×100bp sequencing read length and ∼100 million read depth per sample ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA libraries were then sequenced using the HiSeq 4000 (Illumina) and NovaSeq X Systems (Illumina).
-
bioRxiv - Neuroscience 2020Quote: ... Samples were sequenced single-end using 50 bp reads on the HiSeq-2500 and Hi-Seq 4000 platforms (Illumina, San Diego, USA).
-
bioRxiv - Genetics 2022Quote: ... Final library concentrations were diluted to 4nM and submitted for sequencing on the Illumina Hi-Seq 2500 (Illumina, San Diego, CA, USA), 125bp SE in the GSL ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... cDNA libraries were singe-end sequenced in 76 cycles using a NSQ 500/550 Hi Output KT v2.5 (Cat #20024906 Illumina, San-Diego, CA) in one multiplex run (N=3/exposure group) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 300pM of the pooled library was loaded onto a NovaSeq S1 flowcell (Illumina p/n 20012865), using the Standard Workflow loading conditions designated by the manufacturer and amplified by exclusion amplification (ExAMP ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA primers TS Primer-X (“X” stands for barcode index; CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCCTTGGCACCCGAG AATTCCA, N=standard Illumina barcodes) and TS Primer-1 (AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATC ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... Fragments were amplified for 15 cycles with unique dual index tags and sequenced using paired end reads extending 150 bases (Illumina NovaSeq-6000).
-
bioRxiv - Cell Biology 2021Quote: ... Eluted libraries were quantified using a Qubit dsDNA HS Assay Kit and sequenced on a NextSeq 500 or Hi-Seq 4000 (Illumina, San Diego, California). A list of the RNA-Seq samples can be found in Supplementary Table 5.
-
bioRxiv - Developmental Biology 2020Quote: ... The samples were pooled at a concentration of 5nM and run on an Illumina HI-SEQ 2500 sequencer (Illumina, Inc. San Diego, CA) to obtain paired-end reads of 75 bases (PE75) ...
-
bioRxiv - Genomics 2024Quote: ... Hi-C libraries for scaffolding were generated and sequenced by Arima Genomics (200.48 million PE 150-bp reads; Illumina NovaSeq; Arima Genomics, USA). To aid gene annotation ...
-
bioRxiv - Cell Biology 2023Quote: ... were used instead of the primers that came with the SMARTer Stranded Total RNA HI Mammalian kit to allow for sequencing on the NovaSeq (Illumina, San Diego, CA) by the Biopolymers Facility at Harvard Medical School.
-
bioRxiv - Evolutionary Biology 2023Quote: ... multiplexed and sequenced as 150 bp paired-end reads using two lanes on an Illumina Hi-Seq 2000 (Illumina, San Diego, CA, USA) through Novogene (Beijing ...
-
bioRxiv - Developmental Biology 2021Quote: ... The cDNA library was then sequenced on an Illumina NextSeq500 (Illumina) using the NextSeq500/550 High Output v2.5 Kit (Illumina) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cDNA library was sequenced with a NextSeq 500 instrument (Illumina) using 150-bp paired-end reads with a NextSeq 500 High Output Kit (300 cycles).
-
bioRxiv - Genomics 2020Quote: Libraries were generated via tagmentation of cDNA (Illumina FC-121-1030) and sequenced ...
-
bioRxiv - Immunology 2021Quote: ... The cDNA library was sequenced on an Ilumina HiSeq 4000 (Illumina).
-
bioRxiv - Genomics 2021Quote: ... DNA and cDNA samples were sequenced using the HiSeq2500 device (Illumina), as per the 125bp paired-end protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... cDNA libraries were pooled and NGS libraries were constructed by Illumina Nextera XT DNA Library Prep Kit ...
-
bioRxiv - Microbiology 2021Quote: ... Captured cDNA was then prepared into Illumina libraries using NexteraXT (Illumina). Final libraries were quality controlled using Fragment Analyzer (Agilent ...
-
bioRxiv - Developmental Biology 2022Quote: ... Library preparation was performed using the TruSeq cDNA library construction (Illumina). Samples were processed on the Illumina HiSeq 550 sequencing system with the NextSeq 500/550 High Output kit v2.5 (Illumina ...
-
bioRxiv - Molecular Biology 2020Quote: ... The amplified cDNA was sequenced on a NextSeq 500 device (Illumina).
-
Differential expression of transposable elements in stem cell lineages of the preimplantation embryobioRxiv - Developmental Biology 2020Quote: ... cDNA libraries were prepared using a TruSeq Stranded mRNA kit (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was used to prepare a standard barcoded sequencing library (Illumina). Samples were sequenced using an Illumina HiSeq2500 to obtain 50-bp single end reads ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA libraries were prepared using Trueseq Stranded mRNA Prep Kit (Illumina). The cDN A libraries were then sequenced using the Illumina Novaseq 6000 platform with 150 bp paired end reads ...
-
bioRxiv - Immunology 2020Quote: ... The cDNA libraries were generated according to the manufacturer’s protocol (Illumina) and further sequenced (paired-end ...
-
bioRxiv - Immunology 2020Quote: ... and cDNA libraries were generated using Illumina Nextera XT kit (Illumina, Inc. ...
-
bioRxiv - Plant Biology 2023Quote: These cDNA libraries were sequenced using NextSeq 500 (Illumina, CA, USA), and the reads were mapped to the soybean reference genome (Wm82.a2.v1) ...
-
bioRxiv - Neuroscience 2023Quote: cDNA library preparation was performed according to manufacturer’s recommendation (Illumina (TS)) ...
-
bioRxiv - Systems Biology 2023Quote: ... cDNA libraries were pooled and sequenced using v1.5 reagent kit (Illumina) for paired-end sequencing (2×150 ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA libraries were made with the Illumina TruSeq 2.0 (Illumina, CA) kit following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA libraries were sequenced with the HiSeq 4000 Sequencing System (Illumina) at the NGS Integrative Genomics Core Unit (NIG ...
-
bioRxiv - Immunology 2023Quote: ... cDNA libraries prepared by the TruSeq RNA Sample Prep Kit (Illumina) were sequenced using the HiSeq 2000 sequencing system (Illumina) ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA libraries were built with TrueSeq total RNA sample kit (Illumina) and sequencing was performed by an Illumina HiSeq4000 system generating paired-end sequences ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was prepared and amplified using the SmartSeq2 protocol (Illumina, USA) and sequencing libraries were prepared with Pico Nextera kit (Illumina) ...
-
bioRxiv - Plant Biology 2023Quote: ... where cDNA libraries were built (TrueSeq total RNA sample kit, Illumina) and sequencing performed adopting the Illumina Novaseq technology with an average output of 40M paired-end reads (100 bp length ...
-
bioRxiv - Immunology 2024Quote: ... cDNA libraries were sequenced using a NovaSeq6000 (Illumina, San Diego, CA) to a depth of 50,000 reads for RNA and 4,000 reads for T cell receptors (TCRs ...
-
Pangenomic Landscapes Shape Performances of a Synthetic Genetic Circuit Across Stutzerimonas SpeciesbioRxiv - Synthetic Biology 2024Quote: ... cDNA library preparation and sequencing (Illumina NovaSeq 6000 S4 PE150 XP). Across all samples ...
-
bioRxiv - Physiology 2023Quote: ... The cDNA library was sequenced with a HiSeq 2500 (Illumina, USA) with single end ...
-
bioRxiv - Biochemistry 2023Quote: ... cDNA libraries were prepared with TruSeq Illumina Total RNA Stranded (Illumina) with Ribo-zero rRNA depletion (Illumina) ...
-
bioRxiv - Neuroscience 2022Quote: ... Barcoded cDNA libraries were sequenced on the NovaSeq 6000 platform (Illumina).
-
bioRxiv - Plant Biology 2022Quote: ... These cDNA libraries were sequenced using NextSeq 500 (Illumina, Tokyo, Japan), and the produced bcl files were converted to fastq files using bcl2fastq (Illumina) ...
-
bioRxiv - Microbiology 2022Quote: ... and cDNA libraries were generated with the ScriptSeq v2 Kit (Illumina). The samples were sequenced in single end mode on an Illumina HiSeq 2500 device ...
-
bioRxiv - Plant Biology 2023Quote: ... Stranded cDNA libraries were prepared with TruSeq Stranded mRNA kit (Illumina). Paired-end sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: Gene expression data (cDNA microarray profiling, Illumina HT-12 v3 platform) from Molecular Taxonomy of BRCA International Consortium (METABRIC ...
-
bioRxiv - Biochemistry 2023Quote: ... cDNA was column-purified and circularized with CircLigase (Epicentre/Illumina, CL9021K) for 16hrs ...
-
bioRxiv - Neuroscience 2024Quote: ... The cDNA libraries were sequenced using the HiSeq 4000 platform (Illumina) to achieve an average depth of 50,000 reads per cell and 2,500 genes per cell ...
-
Promoting Human Intestinal Organoid Formation and Stimulation Using Piezoelectric Nanofiber MatricesbioRxiv - Bioengineering 2024Quote: ... a cDNA library was created and sequenced using an IlluminaHiSeq2000 (Illumina) with 20 million paired-end reads per sample.
-
bioRxiv - Developmental Biology 2024Quote: ... The cDNA library was prepared using TruSeq stranded mRNA (Illumina, USA) and sequenced using Illumina NovaSeq.
-
bioRxiv - Molecular Biology 2020Quote: ... Human/Mouse/Rat (Illumina, discontinued), and fragmented by incubating with PNK buffer (NEB ...