Labshake search
Citations for Illumina :
201 - 250 of 9737 citations for Human Latent Transforming Growth Factor beta Binding Protein 2 LTBP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Purified dsDNA (2 ng) was used for NGS library generation using the Nextera Flex kit (Illumina) and purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Pathology 2021Quote: ... using the 2×75bp kit or on the HiSeq 2500 platform (100 base, paired end; Illumina) with the libraries clustered at 12-15pM and mixed with 5% PhiX genomic DNA (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... The MiSeq Reagent Kit v.3 (2 x 300 bp) (Illumina Inc., San Diego, California USA) was used for sequencing according to manufacturer’s recommendations.
-
bioRxiv - Genomics 2022Quote: ... 2 μl of each P7 and P5 of Nextera XT Index Kit v2 index primers (Illumina) were added to each well ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2-3 ng of DNA was used as input for TruSeq ChIP Library Preparation Kit (Illumina) with following modifications ...
-
bioRxiv - Microbiology 2023Quote: ... was applied with S2 flow cells and the 2 x 150 bp paired-end kit (Illumina) according to company protocols ...
-
bioRxiv - Genomics 2021Quote: ... four human CNV membranes and four human RPE-choroidal control tissues) were sequenced on the NextSeq 500 (Illumina) with 1 × 75 bp ...
-
bioRxiv - Microbiology 2024Quote: The Illumina TruSeq Stranded Total RNA Sample Prep Kit with Ribo-Zero Human/Mouse/Rat protocol (Illumina, Inc. San Diego, CA, USA) was used for the following steps ...
-
bioRxiv - Genomics 2021Quote: BD Infinium Human Methylation 450 arrays (Illumina) were retrieved from the European Genome-phenome Archive (EGA ...
-
bioRxiv - Neuroscience 2022Quote: ... A Human OmniExpress v1.2 BeadChip array (Illumina) was used post-editing to check for any gross karyotype abnormalities ...
-
bioRxiv - Plant Biology 2020Quote: 126 cDNA libraries were prepared using the Illumina TruSeq RNA Sample Preparation Kit v.2 (Illumina, USA) from isolated RNA ...
-
bioRxiv - Genomics 2020Quote: ... using the Illumina MiSeq platform (2×1300 paired-end; MiSeq Reagent Kit v3 supporting 600-cycles, Illumina). The resulting sequence reads were filtered ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... PCR products were then pooled and paired-end sequenced using the MiSeq Reagent Kit 2 from Illumina. Sequence reads were deposited to the SRA database with accession number ...
-
bioRxiv - Plant Biology 2021Quote: ... RNAseq libraries were prepared using the Illumina TruSeq RNA sample preparation kit v.2 (Illumina, CA, USA) and barcoded individually following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... using 2×75bp paired-end reads with a High Output 150 cycle kit (Illumina, FC-404-2002).
-
bioRxiv - Genetics 2022Quote: ... with a 2×250 bp paired-end running method (MiSeq Reagent Nano Kit v2 500 cycles, Illumina). The flow cell was loaded with 5 picomolar pooled libraries containing 5% PhiX control V3 (Illumina) ...
-
bioRxiv - Microbiology 2019Quote: ... We performed paired end sequencing (2 x 300 bp) using the MiSeq reagent Kit V3 (Illumina Inc.) on the MiSeq system (Illumina Inc. ...
-
bioRxiv - Microbiology 2019Quote: ... and used for whole genome sequencing (WGS) (Nextera XT kit; Illumina NextSeq, paired-end, 2 × 150 bp). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... 5μL of Nextera XT Index 2 Primers (S5XX) (both from the Nextera XT Index kit, Illumina, USA), 10μL PCR grade water and 25 μL of KAPA© HiFi Hot Start ReadyMix (Roche ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... cDNA libraries were prepared using the Illumina TruSeq RNA sample preparation kit v.2 (Illumina, CA, USA) and sequenced in single-end 100 bp reads on an Illumina HiSeq4000 (Supplementary Table 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were sequenced by novoGene using the NovaSeq 6000 System and an S4 2 ×150 kit (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... with a paired end 2 × 150bp read using the MiSeq Reagent Nano Kit v2 (300 cycles) (Illumina), with 1% PhiX control spiked in ...
-
bioRxiv - Genetics 2022Quote: ... cDNA libraries were prepared using the Illumina TruSeq RNA sample preparation kit v.2 (Illumina, CA, USA) and sequenced in single-end 100-bp reads on an Illumina HiSeq4000 ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries were sequenced using 2 x 300 bp paired end v3 reagent kit (Illumina, following manufacturer’s protocols). Short read paired-end data were filtered ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cDNA libraries were prepared using the Illumina TruSeq RNA sample preparation kit v.2 (Illumina, CA, USA). Sequencing was performed on an Illumina HiSeq XTen/NovaSeq/BGI platform by a commercial service (Biomarker Technologies ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... using the MiSeq Reagent Kit v3 supporting 600-cycles of 2 x 300 paired-end reads (Illumina). The resulting sequence reads were filtered following a cut-off of Phred quality scores ≥30 and read length ≥75 bases ...
-
bioRxiv - Genomics 2020Quote: ... 7.8 and 15.2 kb) were prepared using Illumina TruSeq DNA LT Sample Prep Kits and Nextera Mate Pair Sample Preparation Kits (Illumina Inc., San Diego, CA, USA), following the manufacturer’s protocols ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 (Illumina) were used for construction of complementary DNA libraries and the complementary DNA libraries were sequenced on a NextSeq 500 system (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 (Illumina) and the HiSeq Rapid SBS Kit v2-HS (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 (Illumina) for the sequencing.
-
bioRxiv - Immunology 2023Quote: ... 2 (Illumina) was the primer source ...
-
bioRxiv - Immunology 2024Quote: ... Gene expression and surface protein libraries were generated using the Chromium Next GEM Single Cell 3 ’Reagent Kits v3.1 and sequenced by Illumina MiSeq or NextSeq2000 ...
-
bioRxiv - Systems Biology 2023Quote: ... a 20 bp placeholder barcode sequence (GGCACTGTAGTCGATAGCCT; bait barcode) and an SP1 Illumina primer binding site (Illumina, San Diego, CA) was cloned in pRS41643 digested with KpnI-HF (New England Biolabs ...
-
bioRxiv - Cancer Biology 2019Quote: DNA methylation data (Illumina human methylation 450k BeadChip) and clinical information of 8,118 patients across 24 tissue types were obtained from in GDC data portal [29] using TCGAbiolink (Bioconductor package ...
-
bioRxiv - Genetics 2024Quote: The Infinium Human Methylation EPIC BeadChip (Illumina, USA) array was performed according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Methylation data (Illumina Human Methylation 450 platform) for TCGA cohorts were downloaded from the Firebrowse website hosed by Broad Institute of MIT and Harvard ...
-
bioRxiv - Genomics 2020Quote: ... Paired-end 2×100 bp RNA-sequencing (Illumina TruSeq RNA Library Prep Kit, Illumina HiSeq2000 and Illumina HiSeq4000) was performed ...
-
bioRxiv - Developmental Biology 2019Quote: ... in paired-end mode with a read length of 2 × 100 bp using TruSeq SBS Kit v4 (Illumina). Each sample was sequenced in a fraction of a sequencing v4 flow cell lane ...
-
bioRxiv - Genomics 2021Quote: ... according to manufacturer”s instructions and sequenced using a 2 × 250-cycle MiSeq Reagent kit v3.0 (Illumina, CA).
-
bioRxiv - Cell Biology 2022Quote: ... Paired-end 2×100 bp RNA-sequencing (Illumina TruSeq RNA Library Prep Kit, Illumina HiSeq2000 and Illumina HiSeq4000) was performed ...
-
bioRxiv - Cell Biology 2022Quote: ... Paired-end 2×100 bp RNA-sequencing (Illumina TruSeq RNA Library Prep Kit, Illumina HiSeq2000 and Illumina HiSeq4000) was performed ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were sequenced using the NovaSeq SP Reagent kit (2 × 150 cycles) from Illumina (San Diego, CA, USA). Sample L5630 underwent a target enrichment approach where double stranded DNA (synthesized using the QuantiTect Reverse Transcription Kit from Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... Transposon mutagenesis was performed with the EZ-Tn5
2>Tnp Transposome kit (Epicentre, Illumina, CA, USA) and the insertion site of all mutants was determined via arbitrary PCR (Segev et al ... -
bioRxiv - Microbiology 2021Quote: ... The sequencing library was prepared using the Nextera XT V.2 Index Kit (Sets A and D, Illumina) according to the Illumina 16S MiSeq Sequencing Library protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... in paired-end mode on Illumina (2×101 bp) using TrueSeq DNA exome kit (v.6) (Illumina Inc.). Paired-end reads were aligned to the human reference genome sequence GRCh38 using BWA–MEM (V0.715-r1140 ...
-
bioRxiv - Genomics 2020Quote: ... Paired-end 2×100 bp RNA-sequencing (Illumina TruSeq RNA Library Prep Kit, Illumina HiSeq2000 and Illumina HiSeq4000) was performed ...
-
bioRxiv - Genomics 2020Quote: ... Paired-end 2×100 bp RNA sequencing (Illumina TruSeq RNA Library Prep Kit, Illumina HiSeq2000 and Illumina HiSeq4000) was performed ...
-
bioRxiv - Genomics 2020Quote: ... Paired-end 2×100 bp RNA sequencing (Illumina TruSeq RNA Library Prep Kit, Illumina HiSeq2000 and Illumina HiSeq4000) was performed ...
-
bioRxiv - Microbiology 2022Quote: ... The cleaned pool was sequenced on the Illumina MiSeq using v.2 2_250 base-pair kit (Illumina, Inc). Two PCR controls were also sequenced to test for PCR reagent contamination.
-
bioRxiv - Microbiology 2023Quote: ... and paired-end sequenced (2 × 300 bp) on a MiSeq sequencer using the MiSeq Reagent kit V3 (Illumina). Geneious was used to trim the sequencing data (using BBduk ...