Labshake search
Citations for Illumina :
201 - 250 of 1013 citations for 7 Chloro 9 methyl 3 4 dihydro 2H benzo b oxepin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Genomics 2020Quote: ... sequencing reads were mapped to reference viral genome sequence and consensus sequence for each sample was built using Dragen RNA pathogen detection software (version 9) in BaseSpace (Illumina Inc, USA). For amplified whole-genome sequencing ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNAs from WT and e2fabc at 9 DAG were used for construction of cDNA libraries using the TruSeq RNA Library Preparation Kit v2 (Illumina, United States) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Plant Biology 2019Quote: ... Libraries were constructed using Illumina TruSeq RNA Single Indexes (Set A and B; Illumina, CA, USA) in a 14-cycle indexing PCR reaction ...
-
bioRxiv - Microbiology 2020Quote: ... B) Informatics benchmarking (‘Experiment 2’) in which a seawater virome was sequenced with short-reads (Illumina) and long-read sequencing ...
-
bioRxiv - Plant Biology 2020Quote: Illumina library preparation followed a modification of the Illumina 16S metagenomic protocol (Illumina #15044223 Rev. B) where all loci specific primers have a 33 bp tail added to the 5’ end ...
-
bioRxiv - Genetics 2023Quote: ... B-allele frequency (BAF) and log-likelihood (LRR) data were generated using GenomeStudio v2.0.5 (Illumina Inc.) with a custom cluster file created according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Libraries were sequenced on one lane of a HiSeq4000 (PE 150; Illumina San Diego, California).
-
bioRxiv - Genomics 2019Quote: ... four Illumina libraries were prepared and sequenced on a HiSeq2000: one paired-end library (Illumina TruSeq DNA PCR-free LT Sample Prep kit #15036187 ...
-
bioRxiv - Neuroscience 2020Quote: ... mixed in equimolar ratios and sequenced on one flow cell of NovaSeq S Prime (Illumina).
-
bioRxiv - Molecular Biology 2021Quote: ... Sequencing was carried out on one lane of an Illumina 2500 Hiseq instrument (Illumina Inc.) using 125 cycle chemistry in paired-end (PE ...
-
bioRxiv - Biochemistry 2020Quote: ... The sample was submitted to one channel of Illumina flow cell and sequenced by Illumina Genome Analyzer (GAII ...
-
bioRxiv - Genomics 2021Quote: ... Metagenomic sequencing was performed on one SP lane of the NovaSeq 6000 sequencing system (Illumina) at the Roy J ...
-
bioRxiv - Cancer Biology 2022Quote: ... the library from patient one was sequenced with an Illumina HiSeq 4000 (Illumina, Berlin, Germany) at the DKFZ Genomics and Proteomics Core Facility in Heidelberg and all other libraries were sequenced on an Illumina NovaSeq 6000 (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... one nanogram of DNA was fragmented and adapter ligated using the Nextera XT kit (Illumina) and unique 8bp dual-index adapters (IDT ...
-
bioRxiv - Developmental Biology 2023Quote: ... the libraries were multiplexed into one pool and sequenced using the Illumina HiSeq2500 instrument (Illumina) at National Institute for Basic Biology in Okazaki ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and the 7 other libraries were single-end sequenced using 50 cycles on a HiSeq2500 sequencer (Illumina) at the IGBMC GenomEast Platform (Illkirch ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Genomic DNA (7 ng) from each sample was first fragmented using a partial Nextera reaction (Illumina, Inc), which also ligates short adapter sequences to the ends of the fragments ...
-
bioRxiv - Neuroscience 2020Quote: ... Paired-end 75bp to sufficient read depth with PhiX spike-in controls (7%) (Illumina San Diego, CA).
-
bioRxiv - Neuroscience 2020Quote: ... Paired-end 75bp to sufficient read depth with PhiX spike-in controls (7%) (Illumina San Diego, CA).
-
bioRxiv - Genomics 2019Quote: ... The capture libraries were sequenced on MiSeq (9 samples per run) or HiSeq (96 samples per run) NGS platforms (Illumina, San Diego, CA) as previously described24 ...
-
bioRxiv - Neuroscience 2021Quote: ... with 5 ng input RNA followed by 9 cycles of PCR amplification and library preparation using the Nextera XT DNA Library Prep Kit (Illumina, San Diego, CA). Sequencing was performed on a NovaSeq 6000 (Illumina) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Sequencing libraries were prepared according to the TruSeq stranded total library preparation kit with RiboZero Gold treatment (Illumina, Inc., Cat No.20020598/9). Paired-reads (150 bp ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples with an RNA integrity number of > 9 were used for construction of a complementary DNA library by an Illumina TruSeq kit (Illumina, San Diego, CA). The sequencing strategy was 100 bp paired-end by an Illumina HiSeq 4000 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 in treatment d28_0 and 5 from d28_100 (Illumina HiSeq, 2×150bp, GenoScreen, France). Reads corresponding to animal sequences were identified by aligning each dataset against Oryzias latipes available at the NCBI ...
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...
-
bioRxiv - Biophysics 2021Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Table S1) ...
-
bioRxiv - Genomics 2019Quote: ... to generate ~3 GB data (Illumina, Inc, USA). The total yield of the Number of Paired end was 26,263,128 with the maximum data of 3.78 GB ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... A TruSeq SBS sequencing kit version 3 (Illumina) was used following the manufacturer’s instructions to generate the sequencing libraries ...
-
bioRxiv - Biophysics 2022Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Supplementary Table 1) ...
-
bioRxiv - Genomics 2023Quote: ... and alternating reverse oligos (3’ P7 Illumina adapter). The demulitplexing primers used for PCR2 are listed in Extended Data Table 4 ...
-
bioRxiv - Biophysics 2023Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (Supplementary Table 3 ...
-
bioRxiv - Microbiology 2021Quote: ... 5) DC3000 + C (Illumina only), 6 ...
-
bioRxiv - Immunology 2022Quote: ... and 5 µl Tn5 (Illumina) in nuclease-free water or in 50 µl tagmentation mix “Corces et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 ul TDE1 (Illumina 20034197)) and shaken at 1000 RPM for 30 minutes at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... The B allele frequency (BAF) and the log R ratio (LRR) were extracted from GenomeStudio (Illumina, USA) for representation.
-
bioRxiv - Neuroscience 2020Quote: ... The B allele frequency (BAF) and the log R ratio (LRR) were extracted from GenomeStudio (Illumina, USA) for representation.
-
bioRxiv - Evolutionary Biology 2023Quote: ... cDNA libraries were prepared according to the 16S Metagenomic Sequencing Library Preparation protocol (15044223 Rev. B, Illumina). Libraries were indexed using Nextera XT Index Kit (FC-131-1002/Illumina) ...
-
bioRxiv - Genomics 2019Quote: ... Bead-bound Hi-C DNA was amplified with 7 PCR amplification cycles using PE PCR 1.0 and PE PCR 2.0 primers (Illumina). After PCR amplification ...
-
bioRxiv - Developmental Biology 2022Quote: ... Six barcoded samples were pooled in one lane of the flow cell and sequenced by Illumina NextSeq 750 (MidOutput run) ...
-
bioRxiv - Neuroscience 2019Quote: ... Sequencing was performed on one High-Output lane of an Illumina NextSeq 550 (Illumina, California, USA) in paired-read 150 bp format ...
-
bioRxiv - Cancer Biology 2021Quote: ... one fraction was used for WGS on NovaSeq6000 at PE2×150 cycles (Illumina, San Diego, CA) and another fraction was normalized and pooled at 4 samples from tumor samples and 4 samples for germline samples ...
-
bioRxiv - Molecular Biology 2020Quote: ... before combining 6 samples into one flow cell for sequencing on a HiSeq 2000 sequencer (Illumina).
-
bioRxiv - Cell Biology 2020Quote: ... into an even pool and sequenced across one 2Ø150nt lane of the NovaSeq 6000 (Illumina, CA) at a depth of ∼50,000 reads per cell ...
-
bioRxiv - Genetics 2021Quote: ... One microgram of total RNA depleted of ribosomal RNA using the Ribozero kit (Illumina Cat # MRZG12324) was used for the preparation of sequencing libraries using RNA Tru Seq Kits (Illumina (Cat # RS-122-2001-48) ...
-
bioRxiv - Zoology 2022Quote: ... Fish were sequenced for 100 base pair reads on one lane of a NovaSeq 6000 (Illumina). A mean of 98.3 million (± 38.9 million standard deviation (s.d.) ...
-
bioRxiv - Genomics 2023Quote: We sequenced one elephant reference genome (Em538) to ~60× (2 lanes of Illumina Hiseq X Ten) coverage and eight additional female genomes (4 Asian and 4 African ...