Labshake search
Citations for Illumina :
201 - 250 of 599 citations for 4 4 7 Triethoxy 7 Methyl 3 8 Dioxa 4 7 Disiladecane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... cell nuclei were isolated and transposed with 8 μL Tn5 (Illumina Nextera) at 37°C for 60 minutes ...
-
bioRxiv - Bioengineering 2023Quote: Total RNA samples (RIN > 8) were sequenced on HiSeq 1500 (Illumina Inc.) using HiSeqV2 Rapid chemistry according manufacturer’s instructions in Monash Health Translation Precinct RNA-Seq facility ...
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were sequenced 2 * 50+8+16 bp on a HiSeq2500 sequencer (Illumina). RNA-seq data were processed according to Doyle et al ...
-
bioRxiv - Systems Biology 2023Quote: ... and biotinylated as described 8 using HumanHT-12 v4 Expression BeadChips (Illumina, Inc.). Gene expression data were extracted and log2-transformed using GenomeStudio software (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... 8 µL of i7 primer (NEBNext Multiplex Oligos for Illumina (Dual Index primers); NEB #E7600S ...
-
bioRxiv - Microbiology 2024Quote: ... diluted to 8 pM in Illumina’s HT1 buffer (Illumina: San Diego, CA, USA), spiked with 15% PhiX ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 8 cycles and using Nextera XT indexes (Illumina, Cat: # FC-131-1001) according to the 16S Metagenomic Sequencing Library Preparation Protocol from Illumina ...
-
bioRxiv - Systems Biology 2024Quote: ... was amplified using the primers SYM_VAR_5.8S2: 5′ (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG)GAATTGCAGAACTCCGTGAACC 3′ and SYM_VAR_REV: 5′ (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG)CGGGTTCWCTTGTYTGACTTCATGC 3′ (50) (Illumina adaptor overhangs underlined). For all samples ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2024Quote: ... and an independent validation set (3 Illumina HumanMethylation450K array studies ...
-
bioRxiv - Genomics 2024Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Systems Biology 2022Quote: ... Individual samples were hybridized to Illumina MouseRef-8 Expression BeadChips (Illumina, San Diego, CA) by Southern California Genotyping Consortium (SCGC ...
-
bioRxiv - Cell Biology 2022Quote: ... 8 plates of mRNA libraries were sequenced using the Nextseq550 high output kit (Illumina) with 35 paired-end reads according to the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2021Quote: ➢ Distinct from currently used length 8 barcodes from common library kits (Illumina TruSeq, NEB)
-
bioRxiv - Systems Biology 2020Quote: ... i7 index 8 cycles and Read 2 56 cycles on a NextSeq500 instrument (Illumina) using High Output v2.1 chemistry ...
-
bioRxiv - Genetics 2020Quote: ... Pooled and denatured library (8 pM) containing 5% volume of PhiX (control library; Illumina) was sequenced using the Illumina MiSeq system with MiSeq Reagent Kit V3 (300-bp paired-end reads ...
-
bioRxiv - Cancer Biology 2020Quote: ... ATAC-seq libraries (~8 per lane) were sequenced on a HiSeq 4000 platform (Illumina) by the University of Manchester Genomic Technologies Core Facility ...
-
bioRxiv - Immunology 2020Quote: PBMCs from 10 donors were genotyped using Infinium Omni2.5-8 v1.3 BeadChip Array (Illumina) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... diluted to a concentration of 4pM and an 8% denaturalized PhiX control (Illumina, USA) was added ...
-
bioRxiv - Neuroscience 2023Quote: ... Whole-genome SNP genotyping (SNP array) was conducted using Infinium OmniExpressExome-8-BeadChip (Illumina) and GenomeStudio V2.0.3 (Illumina ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2024Quote: ... 16S rRNA PCR amplification and next-generation sequencing were performed at MR DNA (www.mrdnalab.com) using primers 515F-Y (5’-GTGCCAGCMGCCGCGGTAA-3’)73 and 806R (5’-GGACTACHVGGTWTCTAAT-3’)74 using Illumina MiSeq (Illumina Corp) 2x300 paired- end reads ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by PCR amplification of the gRNAs using forward (5’-CGATACAAGGCTGTTAGAGAGATA-3’) and reverse (5’-GTTGCTATTATGTCTACTATTCTTTCCC-3’) primers and NEBNext HighFidelity 2X PCR Master Mix (Illumina). Library preparation was performed with the Nextera DNA Flex Library Prep Kit (Illumina ...
-
bioRxiv - Biophysics 2021Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Table S1) ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... A TruSeq SBS sequencing kit version 3 (Illumina) was used following the manufacturer’s instructions to generate the sequencing libraries ...
-
bioRxiv - Biophysics 2023Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (Supplementary Table 3 ...
-
bioRxiv - Biophysics 2022Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Supplementary Table 1) ...
-
bioRxiv - Genomics 2024Quote: ... and alternating reverse oligos (3’ P7 Illumina adapter). The demulitplexing primers used for PCR2 are listed in Extended Data Table 4 ...
-
bioRxiv - Microbiology 2024Quote: ... version 3 (2×300 bp read length; Illumina), following to the manufacturer’s instruction.
-
bioRxiv - Immunology 2024Quote: ... using the TruSeq SBS Kit v.3 (Illumina). An average of 75 million paired reads was generated per sample.
-
bioRxiv - Molecular Biology 2023Quote: ... and each sample was sequenced in 3 different lanes (3 technical replicates per sample) on an Illumina HiSeq platform (Illumina, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Neuroscience 2024Quote: Biomarker Core Facility at King’s College London for library preparation (single cell 3’ version 3 on a Chromium 10X instrument) and sequencing (Illumina NextSeq system).
-
Targeted rescue of synaptic plasticity improves cognitive decline after severe systemic inflammationbioRxiv - Neuroscience 2021Quote: ... 58°C on two Illumina MouseRef-8 v2.0 Expression BeadChips (Illumina, San Diego, CA, USA). Post-hybridization data read-out ...
-
bioRxiv - Neuroscience 2022Quote: ... Genotyping array analysis was performed by Psomagen with an Infinium Omni 2.5-8 kit (Illumina). To detect SVA ...
-
bioRxiv - Immunology 2020Quote: ... We genotyped patients using the Illumina OmniExpressExome-8 Bead Chip (Illumina, San Diego, CA, USA).
-
bioRxiv - Genetics 2020Quote: ... The samples were sequenced on a total of 8 lanes using a HiSeq3000 instrument (Illumina) with a single end flowcell for 75 cycles ...
-
bioRxiv - Neuroscience 2024Quote: ... Genotypes were determined with the Illumina Infinium Omni2.5M-8 array (Illumina, San Diego, CA, USA). The PLINK toolset (http://pngu.mgh.harvard.edu/purcell/plink/ ...
-
bioRxiv - Genetics 2024Quote: ... with genotyping performed using the Infinium Global Diversity Array-8 v.10 Kit (Illumina #20031669). RNA extraction utilized the RNeasy kit (Qiagen #74104 ...
-
bioRxiv - Neuroscience 2021Quote: ... using TruSeq SR Cluster Kit 3-cBot-HS (Illumina) and TruSeq SBS Kit 3-HS (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
bioRxiv - Immunology 2024Quote: ... 3 biological replicates were sequenced with NextsSeq 550 (Illumina). For data analysis ...