Labshake search
Citations for Illumina :
201 - 250 of 1579 citations for 2 Chloro 3 6 chlorohexanoyl pyridine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... and day 3 RNA using the TruSeq Stranded mRNA Library Prep Kit (Illumina 20020594) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: Transposed DNA fragments were purified using the Qiagen MinElute kit and amplified 6-8 cycles using the Nextera (Illumina) PCR primers ...
-
bioRxiv - Immunology 2020Quote: ... Libraries were sequenced on the iSeq (cases 1 - 6 and controls) or NovaSeq 6000 (case 7 and controls) (Illumina) using 150nt paired-end reads.
-
bioRxiv - Evolutionary Biology 2023Quote: ... scRNA-seq libraries were pooled at equimolar concentration and sequenced to saturation (median 6 reads/UMI) on an Illumina NextSeq 500 sequencer and using high-output 75 cycles v2.5 kits (Illumina), obtaining 483M reads in total ...
-
bioRxiv - Microbiology 2023Quote: For array-based gene expression analysis: Analysis of gene expression was performed using the MouseWG-6 v2.0 array (Illumina), following quality testing of mRNA using an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Genomics 2024Quote: ... RPF library sequencing Fastq files (de-barcoded at the NHLBI core facility according to their 6-nt Illumina barcodes) were trimmed of their linkers and separated according to their 5-nt internal sample barcode using CUTADAPT ...
-
bioRxiv - Genomics 2021Quote: ... Library preparation followed the TruSeq mRNA 2 (Illumina, USA) protocol and libraries were sequenced on an Illumina HiSeq 2500 platform (two lanes of 125 bp paired-end sequencing) ...
-
bioRxiv - Genomics 2021Quote: ... and sequenced with NovaSeq 6000 (2×150 bp) (Illumina). DNA was isolated from paired tumor-normal samples also using the AllPrep DNA/RNA/Protein Mini kit ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and TruSeq RNA Sample Preparation Kit version 2 (Illumina) according to the manufacturers’ protocols ...
-
bioRxiv - Molecular Biology 2020Quote: ... and sequencing (HiSeq, 2 × 150bp paired end, Illumina®) were performed by GENEWIZ (South Plainfield ...
-
bioRxiv - Genomics 2022Quote: ... following manufacturer’s recommendations and sequenced by Illumina HiSeq 2×150 cycles run (Illumina Inc., CA, USA).
-
bioRxiv - Genomics 2022Quote: ... refringens positive and negative samples were generated for RNAseq library construction and sequencing using the same protocol as described above and sequenced by Illumina HiSeq 2×150 cycles run (Illumina Inc., CA, USA).
-
bioRxiv - Evolutionary Biology 2020Quote: ... franciscae strain CBS2926T (Illumina, PE 2 x 100 bp) were sequenced and assembled at INRAE Montpellier ...
-
bioRxiv - Developmental Biology 2020Quote: ... 12 million 2×150 bp reads (Illumina Nextseq 500) were sequenced for each library.
-
bioRxiv - Genomics 2020Quote: ... PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina; see Supplementary Table 2) were not processed through hybridization and sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... for each sample 2 μl of 5’ adapter (Illumina) (total 12 μl ...
-
bioRxiv - Developmental Biology 2023Quote: ... read 2 - 91 cycles) performed with Nextseq 500 (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... by 2×150 Paired End (PE) configuration by Illumina HiSeq ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA libraries with 2 % spiked-in PhiX control (Illumina) were sequenced at the 100-bp paired end on a P3 flow cell using an Illumina NextSeq2000 instrument at a sequencing depth of ∼80 K reads per cell ...
-
bioRxiv - Immunology 2022Quote: ... and RNA sequencing (Illumina HiSeq, 2 x 150 bp).
-
bioRxiv - Cancer Biology 2023Quote: ... After cluster generation on cBot 2 (Illumina, SanDiego, USA) using the HiSeq 3000/4000 SR Cluster Kit (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... Libraries (2×145 bp Illumina-compatible paired-end reads) were sequenced on a MiSeq® instrument (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... Read 2 and Index Read—were obtained from Illumina MiSeq ...
-
bioRxiv - Cell Biology 2024Quote: ... The library was spiked with 2% PhiX library (Illumina) and sequenced on an iSeq 100 system.
-
bioRxiv - Microbiology 2020Quote: ... One microgram of gDNA with a DNA integrity number (DIN) of <=6 was used for library preparation using the TruSeq PCR-free library preparation kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... DNA-Seq libraries were prepared using Nextera XT library preparation kit with 700 pg DNA input per sample and 6:30 min tagmentation at 55 °C and barcoded using Nextera XT indexes (Illumina). RNA-Seq libraries were prepared using KAPA RNA HyperPrep kit (Roche ...
-
bioRxiv - Immunology 2023Quote: ... all indexed libraries were pooled with 6% PhiX spike-in DNA and sequenced using a MiSeq Reagent Nano Kit v2 (500 cycles) (Illumina) at the Fralin Genomics Sequencing Center.
-
bioRxiv - Cancer Biology 2024Quote: ... The paired-end reads of 150 bp were generated in an S4 flowcell with v1.5 sequencing chemistry on a NovaSeq-6 000 platform (Illumina Inc.). Read quality was checked by FastQC tool v0.11.9 ...
-
bioRxiv - Bioengineering 2023Quote: ... pair-end single index sequencing parameters were adjusted to 101/6/0/86 (as opposed to 74/6/0/86) to effectively utilize the capabilities of the NovaSeq 200 cycle reagent kit (Illumina). To demultiplex each sample and to generate the matrix of transcript counts in each cell ...
-
bioRxiv - Cell Biology 2022Quote: ... Multiplexed libraries for the 1.5 h samples were generated using the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit and for the 6 h samples using TruSeqHT Stranded Total RNA Library Prep protocol (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... Multiplexing of sgRNA challenge screens in BCBL-1 was performed utilizing 6-bp indexes and sequenced on a single lane of a HiSeq4000 (Illumina) using 50bp single-end (SE ...
-
bioRxiv - Plant Biology 2023Quote: Prepared libraries were pooled and diluted to 6 pM for TruSeq Paired End v4 DNA clustering on one single flow cell lane using a cBot device (Illumina). Final sequencing was carried out on an Illumina HiSeq 2500 platform using 126 ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were sequenced using the MiSeq 2×250 bp and HiSeq 2×150 bp paired-end read technology (Illumina, San Diego, CA, USA) as previously described [78] ...
-
bioRxiv - Genomics 2024Quote: ... and sequenced across three lanes of a HiSeq or pooled for sequencing on a NovaSeq S1 using 2×75 (HiSeq) or 2×101 (NovaSeq) read lengths (Illumina, San Diego, CA). Variant calling and neoantigen prediction were performed as described previously (22,23).
-
bioRxiv - Evolutionary Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina single indexed adapters (Illumina) were ligated ...
-
bioRxiv - Microbiology 2020Quote: ... 3’ adapter sequences from the Illumina TruSeq Small RNA Library Preparation Kit (Illumina, RS-200) were ligated onto the dsRNA species by mixing together 1 μl of adapter with 1 μg dsRNA in a 6 μl reaction and heated at 70°C for 2 minutes ...
-
bioRxiv - Genomics 2022Quote: ... An “A” base was then added to the 3’ end and the adaptor from Illumina was ligated only to one end of the resultant dsDNA as the other end contained a 5’ overhang introduced by the N9 primer ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by A-tailing and ligation at the 3’ ends with paired-end adaptors (Illumina) with a single “T” base overhang ...
-
bioRxiv - Cancer Biology 2021Quote: Four 3’ PCR primers were used each containing a unique index (underlined) recognized by Illumina:
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Biochemistry 2023Quote: ... mRNA libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina). Quality of mRNA libraries was determined using Agilent Tape Station and mRNA was sequenced at 75 bp single read sequencing using NextSeq 500 (Illumina).
-
bioRxiv - Synthetic Biology 2022Quote: ... adding barcodes to identify the sample (primers P3-P15 in Supplementary Table 3, containing Illumina Nextera tagmentation adapters and ...
-
bioRxiv - Genomics 2022Quote: ... SW-8046-2) from libraries prepared using the Nextera XT DNA kit (Illumina, Inc, San Diego, CA, and sequenced on Illumina HiSeq4000 (2×150 bp). WGS data was obtained from six C ...
-
bioRxiv - Cancer Biology 2022Quote: ... generating 2 × 75 base read pairs or on a NovaSeq 6000 generating 2 × 150 base read pairs using standard settings (Illumina, San Diego, CA, USA). BCL output from the sequencing platform was converted to FASTQ using Illumina’s bcl2fastq tool (versions 2.17 to 2.20 ...
-
bioRxiv - Genomics 2024Quote: SARS-CoV-2 genome sequencing was performed on samples that were SARS-CoV-2 RNA-positive using the COVIDSeq Test (Illumina, San Diego, CA, USA). Libraries were sequenced on the Illumina NextSeq2000 instrument using 2×109 paired end reads ...
-
bioRxiv - Molecular Biology 2020Quote: ... Sequencing (Illumina HiSeq 2500, 2 × 50 bp paired-end reads) was performed in the MSKCC Integrated Genomics Operation ...
-
bioRxiv - Plant Biology 2020Quote: ... MiSeq 2×250 bp sequencing (Illumina, San Diego, CA, USA) was performed at the University of Florida’s Interdisciplinary Center for Biotechnology Research.
-
bioRxiv - Microbiology 2020Quote: ... and submitted for 2-by 250-bp Miseq sequencing (Illumina) to the DNA Technologies and Expression Analysis Cores at the UC Davis Genome Center (supported by NIH Shared Instrumentation Grant 1S10OD010786-01).
-
bioRxiv - Microbiology 2021Quote: ... with 2 × 150 bp and a MiSeq reagent V2 (Illumina).
-
bioRxiv - Plant Biology 2023Quote: ... and paired-end sequenced (2×150bp) with a HiSeq3000 (ILLUMINA).