Labshake search
Citations for Illumina :
201 - 250 of 2225 citations for 1 2 Bromoethoxy 3 5 dimethylbenzene 97+% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: We then pooled the original and targeted libraries at a 2:1 molar concentration and sequenced them together on a NovaSeq 6000 (Illumina, 20012850) with a S1 Reagent Kit v1.5 (200 cycles ...
-
bioRxiv - Genetics 2024Quote: ... 1 µg of total RNA was used with the TruSeq RNA Sample Prep Kit v.2 (Illumina, San Diego, CA, USA). The cDNA libraries were quantified by quantitative Real-Time PCR (qPCR) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 × 150 bp flow cells (Illumina).
-
bioRxiv - Cancer Biology 2024Quote: ... 2×150 cycle strategy (Illumina Inc.). Paired-end reads were produced with a 100x coverage ...
-
bioRxiv - Biochemistry 2024Quote: ... Round 2 primers (Illumina TruSeq Adapters) were added to each reaction to 400 nM ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2% PhiX (PhiX Control v3, Illumina) was spiked into the sample and 20 µL were added to an Illumina iSeq 100 i1 Reagent v2 cartridge ...
-
bioRxiv - Neuroscience 2023Quote: ... and sequencing (Illumina HiSeq 2 × 150bp) were all performed at GeneWiz ...
-
bioRxiv - Immunology 2023Quote: ... dual-indexed 3’ DGE libraries were prepared using Nextera XT (Illumina) and sequenced to depth on the NovaseqS4 platform with a paired-end read structure (R1 ...
-
bioRxiv - Immunology 2023Quote: ... Sequencing was performed in 3 sequencing unit of NovaSeq 6000 (Illumina) (100-nt-length reads ...
-
bioRxiv - Immunology 2023Quote: The 3’ adapters were ligated according to the TruSeq kit (Illumina) manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lexogen’s QuantSeq 3’mRNA-seq Library Prep Kit (FWD for Illumina) was utilized for building RNA-seq libraries from 0.1-200 ng of total RNA in 5 µl of nuclease-free ultrapure water ...
-
bioRxiv - Cancer Biology 2024Quote: ... and base calling using the Real-Time Analysis 3 software (Illumina). Demultiplexing and fastq file generation were performed using bcl2fastq v2.20.0.422 software (Illumina) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... DNA solutions of approximately ≥5 ng μL−1 were subjected to the tagmentation reaction using the Nextera DNA Flex Library Prep Kit (Illumina, San Diego, CA) was used at 1/40 scale of the provided protocol ...
-
bioRxiv - Genomics 2023Quote: ... The resulting sequencing libraries were sequenced using the MiSeq system (Illumina v.2 kit, 2 × 150 bp).
-
bioRxiv - Microbiology 2021Quote: ... with 5% (v/v) 20 pM PhiX (Illumina), using 150 cycle v3 cartridges ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2023Quote: ... In each sequencing run 5% of PhiX (Illumina) was included as an internal control ...
-
bioRxiv - Cell Biology 2024Quote: ... spiked in with 5% PhiX Control v3 (Illumina) and sequenced on an Illumina Novaseq 6000 at a depth of ∼50,000 reads/cell with dual index ...
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Physiology 2024Quote: ... sequencing was performed on a NextSeq instrument (2×75bp 2×10) according to the manufacturer instructions (Illumina Inc.) Reads were trimmed and ribosomal RNA reads were removed ...
-
bioRxiv - Molecular Biology 2020Quote: ... was performed using the SureCell WTA 3’ library prep kit (Illumina, 20014279) according to manufacturer’s instructions with minor modifications ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... using 300-cycle kit (v.3, Illumina, Inc., San Diego, CA, USA) to obtain 150 bp paired-end reads.
-
bioRxiv - Neuroscience 2021Quote: ... 3′ gene expression libraries were dual-index sequenced using NextSeq 150bp (Illumina) flow cells by the Duke Center for Genomic and Computational Biology Core Facility.
-
bioRxiv - Cell Biology 2021Quote: ... The final constructed 3’- biased single cell libraries were sequenced by Illumina Nextseq500 machine ...
-
bioRxiv - Immunology 2022Quote: ... and mixed with 3 μl of Illumina TDE1 Tn5 transposase (Illumina, 15027916). Transposition was performed by incubating the prepared reactions on a C1000 Touch thermal cycler with 96–Deep Well Reaction Module (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... or matched the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Microbiology 2023Quote: ... or matching the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Genetics 2023Quote: ... The final constructed 3’-biased single cell libraries were sequenced by Illumina Novaseq6000 machine ...
-
bioRxiv - Developmental Biology 2023Quote: ... distributed over 3 lanes of a HiSeq 2500 with v4 chemistry (Illumina). Sequencing was performed by the Next Generation Sequencing Facility at Vienna BioCenter Core Facilities (VBCF) ...
-
bioRxiv - Immunology 2024Quote: ... and the SureCellTM WTA 3’ Library Prep Kit (Illumina, San Diego, CA). Magnetically enriched NK cells from malaria-naïve subjects were treated with cytokines IL-15 ...
-
bioRxiv - Plant Biology 2024Quote: ... The 3’mRNA-sequencing was performed in a NovaSeq X (Illumina Platform) by Seqplexing (Paterna ...
-
bioRxiv - Systems Biology 2021Quote: ... S4 reagent cartridge (2×100 bp) (Illumina).
-
bioRxiv - Neuroscience 2020Quote: ... ADNI GO/2 participants (Illumina HumanOmniExpress BeadChip), and ADNI3 participants (Illumina Omni 2.5M ...
-
bioRxiv - Microbiology 2020Quote: ... and sequencing (2 × 150 bp, Illumina HiSeq) were performed by Genewiz (South Plainfield ...
-
bioRxiv - Microbiology 2022Quote: ... 2 (Illumina, catalog No. MS-102-2003) by the University of Michigan Microbial Systems Molecular Biology Laboratory as described previously (14) ...
-
bioRxiv - Microbiology 2021Quote: ... 2) merged triplicates for DC3000 + (Illumina only), 3 ...
-
bioRxiv - Microbiology 2022Quote: ... generating 2 × 300bp paired-end reads (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... and sequenced on 2×150 Miseq (Illumina). Clonal abundances were estimated using a pipeline adapted from 110 ...
-
bioRxiv - Molecular Biology 2023Quote: ... or SMART-Seq™ 2 (Illumina, 20040532), followed by NovaSeq (RIP-seq experiments from Figs ...
-
bioRxiv - Immunology 2023Quote: ... and HiSeq2500 V2 2×150bp (Illumina®) protocols at the “Institut du Cerveau” (ICM ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 2.5 µl of each Nextera Index 1 (N7XX) and Nextera Index 2 (N5XX) primers from a Nextera DNA Sample Preparation Index Kit (Illumina, FC-121-1011). PCR was performed according to the following protocol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 12.5 pmol each of the following Illumina primers: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG ATCT and 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCT (the underlined parts will hybridize to the two Illumina flowcell oligos). Temperature cycling consisted of 72 ◻C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Illumina sequencing libraries were generated for 5 αHHβHH mice and 5 αLLβHL mice using TruSeq RNA Sample Preparation Kit v2 (Illumina, San Diego, CA, USA) and sequenced on an Illumina HiSeq2500 platform ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl water) with 2.5 µl transposase (Illumina 20034197) for 30 min at 37 °C with shaking at 1000 r.p.m ...
-
bioRxiv - Neuroscience 2020Quote: ... An additional 5 samples were sequenced on MiSeq (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... spiked with 5% PhiX pre-made library from Illumina and loaded on a Miseq v3 kit (Illumina Inc. ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl PPC (Illumina Nextera DNA Sample Preparation Kit) and 20 μl DNA ...
-
bioRxiv - Immunology 2022Quote: ... mixed with 5% PhiX and sequenced on MiSeq (Illumina) using MiSeq V3 2 × 300 cycle kit (Illumina).
-
bioRxiv - Genomics 2023Quote: ... 5 µL Tn5 transposase (Illumina Cat FC-121-1030) and 22,5 µL nuclease-free H2O and incubated at 37 °C for 30 mins ...