Labshake search
Citations for Illumina :
2051 - 2100 of 2593 citations for 7 Diethylamino 3 5 6 dimethyl 2 benzoxazolyl 2H 1 benzopyran 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... The samples were amplified for 5-8 cycles as determined by qPCR for Illumina sequencing using Nextera library preparation kit (Illumina) and samples were paired-end sequenced on HiSeq4000 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... TASSEL 5 GBS v2 pipeline (52) was used to perform the SNP calling of the sequence data obtained from Illumina sequencing ...
-
bioRxiv - Physiology 2021Quote: ... Single-indexed strand-specific cDNA library from total RNA samples (500 ng input with RIN ≥ 5) was prepared using TruSeq Stranded mRNA Library Prep Kit (Illumina) as per directions by the manufacturer ...
-
bioRxiv - Microbiology 2021Quote: ... 1.5 μg of purified RNA for each sample was processed using the Ribozero rRNA Removal Kit (Gram-negative bacteria) (Illumina) according to the manufacturer’s instructions except that reaction volumes were reduced by 50% ...
-
bioRxiv - Genetics 2021Quote: ... and ribosomal RNA was depleted from 5 ug of total RNA using the Ribo-Zero™ Gold Kit (Illumina, Inc.). Depleted mRNA was fragmented and converted to first strand cDNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting 10 nM pool was denatured to 10 pmol with 5% PhiX spike-in and sequenced as single-read on HiSeq 2500 (Illumina) in rapid mode for 51 cycles (plus 7 cycles index read ...
-
bioRxiv - Microbiology 2019Quote: ... Ribosomal RNA (rRNA) was then depleted from each sample (5 µg each) using the bacterial Ribo-Zero rRNA Removal Kit (Illumina). The integrity of the RNA was evaluated using an RNA 6000 Nano LabChip and an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... Total 5 μg of RNA was used for rRNA depletion by using Ribo-Zero™ (Epicentre, Illumina, Madison, WI USA) kit and purified by using Qiagen-RNeasy miniElute (Qiagen GmbH ...
-
bioRxiv - Immunology 2020Quote: ... 0.3 to 0.5 ng of pre-amplified cDNA was used to generate barcoded Illumina sequencing libraries (Nextera XT library preparation kit, Illumina) in an 8μL reaction volume ...
-
bioRxiv - Genomics 2021Quote: ... The 20 ul preamp was then mixed with 25 ul TD buffer and 5 ul TDE1 buffer (Nextera kit, FC-131-1096, Illumina) and incubated for 5 min at 55 C and held at 10 C ...
-
bioRxiv - Microbiology 2022Quote: ... Ribosomal RNA (rRNA) was subsequently depleted from each RNA sample (5 µg each) using the bacterial Ribo-Zero rRNA Removal Kit (Illumina). The integrity of the RNA was evaluated using an RNA 6000 Nano LabChip and an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’) and Reverse Library primers (5’CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTT CCGATC3’, where NNNNNN denotes the barcodes, e.g. Index1 is CGTGAT for Illumina sequencing). Three rounds of agarose gel purification were performed to purify the fragments of 200~650 bp using QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing was performed at 5 million reads/sample in single-end mode with 150 nt read length on the NextSeq 500 platform (Illumina) using a Mid output sequencing kit ...
-
bioRxiv - Neuroscience 2022Quote: ... Each pool was sequenced on the Illumina NextSeq 500 after the addition of 5% PhiX sequencing control library (FC-110-3002; Illumina) using the following settings ...
-
bioRxiv - Cell Biology 2024Quote: ... The hashtag cDNA and endogenous cDNA libraries were diluted to 4 nM and pooled (5% hashtag + 95 % endogenous cDNA) before being sequenced on a NextSeq2000 sequencer (Illumina).
-
bioRxiv - Cell Biology 2023Quote: ... 30 sec at 62°C and a final extension step of 5 min at 62°C) and sequenced using the NOVASeq platform (Illumina).
-
bioRxiv - Genetics 2023Quote: ... Plasma was divided from maternal peripheral blood (5[mL) by centrifuging and then 600[μL (Ion Torrent) or 1.4 mL (Illumina CN500) plasma was used to extract cell-free DNA ...
-
bioRxiv - Microbiology 2023Quote: ... a PhiX spike-in of 2.5–5% was added to the pools (PhiX sequencing control v3; Illumina FC-110- 3001). Samples were run on the Illumina NovaSeq 6000 platform (single-read 1 ×85 cycles and 6 × i7 index cycles).
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified with AMPure XP purification kit and Sixteen-plexed samples were pooled in approximately equimolar amounts of 5 nM and run in a single and double index reads on a Hiseq 4000 (Illumina).
-
bioRxiv - Genomics 2022Quote: Small RNA libraries were prepared starting from 5 µL RNA eluate using the TruSeq Small RNA Library Prep Kit (Illumina, RS-200-0012 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were pooled at a concentration of 5 nM and run on an Illumina HI-SEQ 2500 sequencer (Illumina) to obtain paired-end reads of 75 bases (PE75) ...
-
bioRxiv - Genomics 2023Quote: ... We used 15 mins incubation on ice in the nuclei preparation step and the Tn5 reaction was performed in 50 μl of custom transposition buffer (10 mM Tris pH 8, 5 mM MgCl2 and 10% dimethylformamide) with 2.5 μl Tn5 transposase (Illumina, 20034197) at 37°C while mixing at 1000 rpm for 30 mins ...
-
bioRxiv - Cell Biology 2023Quote: ... The hashtag cDNA and endogenous cDNA libraries were diluted to 4 nM and pooled (5% hashtag + 95% endogenous cDNA) before being sequenced on a NextSeq2000 sequencer (Illumina).
-
bioRxiv - Genomics 2023Quote: ... groups was based on 5 μg of total RNA according to the manufacturer’s protocol using the Illumina HiScanSQ Instrument (Illumina, USA) and sequenced in the same flow cell as paired-end (2 × 100 bp) ...
-
bioRxiv - Microbiology 2024Quote: ... All samples were pooled to a final concentration of 5-10 ng/µL and sequenced on a NextSeq 500 (Illumina). The demultiplexed data was assembled and SNPs detected with Pilon software using reference genome sequences.84
-
bioRxiv - Immunology 2021Quote: ... Libraries were prepared following 10X Genomics protocols (Chromium Single Cell 3’ Reagent Kits v2 Chemistry) and sequenced on NovaSeq 6000 (Illumina S2 flow cell, paired-end). FASTQ files were processed using cellranger (https://support.10xgenomics.com/single-cell-gene-expression/software/pipelines/latest/what-is-cell-ranger ...
-
bioRxiv - Microbiology 2022Quote: ... and R2-Uni13 (5’-GTC TCG TGG GCT CGG AGA TGT GTA TAA GAG ACA GAG TAG AAA CAA GG-3’) (adaptor and barcode oligonucleotide sequences from Illumina, Inc., San Diego, CA, USA). Annealing and extension steps were performed for 30 s at 55oC and 7 m at 72oC ...
-
bioRxiv - Immunology 2021Quote: ... 1.5 ng cDNA was tagmented using 0.5 μl TruePrep Tagment Enzyme V50 and 1x TruePrep Tagment Buffer L (TruePrep DNA Library Prep Kit V2 for Illumina, Vazyme), followed by an incubation step at 55 °C for 10 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Nuclei were collected by centrifugation and subjected then to transposition reaction in 1x Tagment DNA buffer containing 5% Tn5 Transposase (Illumina, 20034197), 0.1% Tween-20 ...
-
bioRxiv - Microbiology 2021Quote: Purified PCR products were given unique dual indexes at the 5’ end using the Nextera XT Index Kit v2 index primers (Illumina, USA). To attach the index primers ...
-
bioRxiv - Bioengineering 2019Quote: ... incubated and room temperature for 5 minutes and diluted again to a final concentration of 4 pM using HT1 Buffer (Illumina, USA) and loaded into the MiSeq Reagent Nano Kit v2 cartridge (Illumina ...
-
bioRxiv - Immunology 2020Quote: ... Supernatant was discarded and nuclei were re-suspended in 50 μl reaction buffer containing 5.0 μl Tn5 transposase and 10 μl of 5 × TTBL buffer (TruePrepTM DNA Library Prep Kit V2 for Illumina, Vazyme Biotech). The reaction was incubated at 37°C for 30 min ...
-
bioRxiv - Genomics 2021Quote: ... Samples were concentrated using a centrifugal evaporator Speed Vac® to a final volume of 5 μl and we started the TruSeq Small RNA Sample Preparation Kit (Illumina) protocol according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: Sequencing libraries were prepared from 100 ng DNA using the TruSeq Nano DNA sample preparation kit (cat# 20015964/5, Illumina Inc.) targeting an insert size of 350bp ...
-
bioRxiv - Cancer Biology 2020Quote: ... Extracted nuclei was processed for TN-5 mediated tagmentation using the Illumina Tagment DNA Enzyme and buffer kit (Nextera Illumina # 20034210) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Ribosomal RNAs were depleted from 5 μg of total RNA of the sample by Ribo-Zero rRNA Removal Kit (Seed, Root) (Illumina®). After rRNA depletion ...
-
bioRxiv - Genetics 2021Quote: 5× HOT FIREPol® EvaGreen® qPCR Mix Plus with ROX (Solis Biodyne) and an Eco Real-Time PCR System (Illumina) were used for qPCR ...
-
bioRxiv - Genomics 2020Quote: ... the fragmented amplicons were cleaned-up and amplified by 5 cycles of PCR using specific index adapters for Illumina sequencing (Nextera™ DNA CD Indexes, Illumina) (Supplementary Figure 1B) ...
-
bioRxiv - Developmental Biology 2022Quote: ... After centrifugation supernatant was used for RNA cytosolic fraction by adding to 1 ml of TRIZOL and isolated nuclei of CMs were incubated in 30 µl and of EC in 10 µl transposase mixture with 5% Nextera Tagment DNA Enzyme TDE (Illumina #15027916) in transposition buffer (20 mM Tris-HCl pH 7.6 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Nextera libraries (5 replicates) were constructed from 0.8 ng of pre-amplified cleaned up cDNA using Nextera XT Kit (Illumina, Eindhoven, Netherlands). Index PCR was carried out using the custom P5 primer (P5NEXTPT5 ...
-
bioRxiv - Cell Biology 2024Quote: ... from islets was added to 50 μM first-strand RT primer (the sequence at the 5’ portion corresponds to primer P7 on the Illumina flowcell), 10 mM dNTP mix ...
-
bioRxiv - Cell Biology 2024Quote: ... The second-strand cDNA was synthesized by adding 100 μM primer (the specific sequence at the 5′ portion corresponds to the primer for sequencing on the Illumina flowcell), 10× Taq DNA Polymerase Buffer ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing libraries were prepared from 700 ng total RNA using the TruSeq stranded mRNA library preparation kit (Cat# 20020594/5, Illumina Inc.) including polyA selection ...
-
bioRxiv - Microbiology 2023Quote: ... Amplicon libraries were mixed with 5% PhiX and sequenced with MiSeq reagent kits v2 500 cycles (Illumina, San Diego, California, USA). A blank extraction kit control ...
-
bioRxiv - Genomics 2023Quote: A 96-well plate pre-loaded with 5 μl of 500 nM pre-indexed Tn5 transposase per well (iTSM plate, kind gift of Illumina Inc.) was used to multiplex samples and perform barcoded transposition ...
-
bioRxiv - Genomics 2023Quote: ... we pooled these libraries with 5% of bulk ATAC libraries (from an unrelated experiment) and sequenced them on a NextSeq 550 Sequencer (Illumina Inc.) using a High Output Kit with following cycles ...
-
bioRxiv - Neuroscience 2023Quote: ... and a duplicate unrelated control sample was diluted to 5 ng/µl in low TE provided in AmpliSeq Library PLUS (384 Reactions) kit (Illumina, 20019103). AmpliSeq was carried out following the manufacturer’s protocol (document 1000000036408v07) ...
-
bioRxiv - Immunology 2024Quote: ... The 5’ expression library and the V(D)J library were sequenced with NovaSeq 6000 S1 (100 cycles) (Illumina, cat. 20012865).
-
bioRxiv - Microbiology 2023Quote: ... 1 μl of forward and 1 μl of reverse 25 μM PCR primers (Illumina), and 0.5 μl of Phusion high-fidelity DNA polymerase (New England Biolabs) ...
-
bioRxiv - Neuroscience 2023Quote: ... collected with the magnet and resuspended in 24ul of Tagmentation Mix (1:1 Illumina 2× Tagmentation buffer ...