Labshake search
Citations for Illumina :
2001 - 2050 of 2229 citations for SARS CoV 2 Spike Glycoprotein S1 His tag Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... we pooled together the single cell or nucleus libraries from different methods with normalized molar concentrations and loaded them onto a HiSeq2500 (Illumina) in the 8-lane high output or 2-lane rapid run mode to minimize the potential sequencing variation ...
-
bioRxiv - Biochemistry 2019Quote: ... The two cDNA libraries from RNAs of Cfdp1-K1 or dvR2-4 cells were prepared using the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina). Their sequences were obtained using NovaSeq 6000 S4 Reagent Kit by a Nova Sequencing system (S1 Appendix ...
-
bioRxiv - Genomics 2020Quote: The forward indexing primer sequence is - AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC and the reverse indexing primer sequence is - CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG (where the bolded regions are the p5 and p7 flow cell adapters and [i5] and [i7] refer to the index sequence codes used by Illumina). The qPCR step starts with an initial denaturing step at 95 °C for 5 min followed by 35 cycles of denaturation (20s at 98 °C) ...
-
bioRxiv - Genetics 2021Quote: We merged fastq files from the same library when sequenced on multiple flow cells and trimmed the adapters using sequences provided by Illumina with Cutadapt/1.1562 ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were pooled and sequenced single-end for 75 cycles on one high-output flow cell of an Illumina NextSeq with 5% PhiX control (Illumina) added to provide sequence diversity ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were single end (75bp) or pair-end sequenced at 36 bp by 36 bp on a Nextseq550 flow cell (Illumina).
-
bioRxiv - Systems Biology 2020Quote: ... The pools were clustered on a single read flow cell and sequenced for 50 cycles on a HiSeq 4000 sequencer (Illumina). CASAVA (v2.20 ...
-
bioRxiv - Neuroscience 2020Quote: ... single cell and/or nucleus libraries were run using paired-end sequencing with single indexing on the HiSeq 4000 platform (Illumina) by following manufacturer’s instructions (Illumina ...
-
bioRxiv - Neuroscience 2021Quote: ... Libraries were multiplexed on two high-output flow cells and sequenced (using 75 bp reads) on a NextSeq 500 device (Illumina). The mean ± standard deviation (SD ...
-
bioRxiv - Genetics 2020Quote: ... The cell pellet was resuspended with 50 μl transposition mix containing 25 μl 2X TD buffer (Illumina FC-121-1030), 3.5 μl Tn5 transposase (Illumina FC-121-1030) ...
-
bioRxiv - Microbiology 2020Quote: ... A reference genome from strain QMA0248 was constructed using both long reads derived from a single Smrt Cell using the PacBio RS II system with P4C2 chemistry and short reads from Illumina HiSeq2000 derived from Nextera XT paired-end libraries as reported elsewhere (NCBI accession no ...
-
bioRxiv - Plant Biology 2020Quote: ... sequencing was performed with Illumina NovaSeq 6000 system using S4 flow cell with lane divider (Illumina, San Diego, CA, USA). Read length for the paired-end run was 2×151 bp ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was diluted to an average of 200 pg/µl and 100 pg cDNA from each cell and was tagmented using Nextera XT DNA Library Preparation Kit (Illumina). The tagmentation reaction was incubated at 55 °C for 8 min before removing Tn5 from the DNA by adding 0.5 µl NT buffer per well ...
-
bioRxiv - Neuroscience 2021Quote: Six hundred pg cDNA from each plate of cells was used in a modified Nextera XT (Illumina, San Diego, CA) library preparation ...
-
bioRxiv - Cell Biology 2020Quote: ... samples were diluted and pooled into NGS libraries in equimolar amounts and sequenced at 75bp single-read chemistry on an Illumina NS500 MO flow-cell on a Ilumina NextSeq 500 instrument (Illumina) by the Genomics core facility (GCF ...
-
bioRxiv - Neuroscience 2020Quote: ... The pooled exome libraries were distributed across four lanes on an S4 flow cell and sequenced using 150 base pair paired-end approach on a NovaSeq 6000 instrument (Illumina). All sequencing was performed on the Illumina NovaSeq 6000 platform by loading a pool samples to the equivalent loading of 24 samples per flowcell ...
-
bioRxiv - Cell Biology 2020Quote: ... In total 279 single-cell libraries were pooled together and sequenced single-end 50bp on a single lane of a HiSeq4000 (Illumina).
-
bioRxiv - Cell Biology 2021Quote: RNA isolated from colonic epithelial cells was prepared for next-generation sequencing using the stranded RNA library preparation kit with rRNA depletion (Illumina) and sequenced using an Illumina HiSeq 2500 with 100bp single reads ...
-
bioRxiv - Cell Biology 2020Quote: ... 50,000 nuclei were purified from WT or Sun dKO cells and DNA was tagmented using the Nextera Library Prep Kit (Illumina). Tagmented DNA was purified using the Qiagen MinElute PCR Purification kit ...
-
bioRxiv - Genomics 2020Quote: We compiled 64 published and newly generated DNAm datasets of untreated primary cells with reliable information on passage numbers (all Illumina 450k Methylation BeadChip ...
-
bioRxiv - Microbiology 2022Quote: ... Libraries were loaded on individual flow cell lanes and sequenced at a depth of 400 million reads using a HiSeq X Ten platform (Illumina) at Macrogen (Seoul ...
-
bioRxiv - Cancer Biology 2022Quote: ... The final pool was loaded in one lane of an S2 flow cell using the NovaSeq XP protocol (Illumina Inc.) (Figure S3 ...
-
bioRxiv - Cell Biology 2022Quote: Low-pass whole-genome sequencing (∼7x) of the different Pfn1 knock-out clones and WT MC3T3 cells was performed on a HiSeq 4000 (Illumina) to obtain 100 bp paired-end reads ...
-
bioRxiv - Cell Biology 2022Quote: ... The resulting cDNAs from individual cells were used for the construction of NGS libraries with the Nextera XT DNA sample preparation kit (Illumina). Libraries were pooled ...
-
bioRxiv - Neuroscience 2022Quote: ... Libraries were sequenced on a HiSeq 2000 and/or HiSeq2500 on a 1×50 bp single read (SR) flow cell (Illumina) at an average of 20M reads/sample ...
-
bioRxiv - Microbiology 2022Quote: ... The cDNA pools were sequenced using the NextSeq 500 system (HighOutput flow cell, 400 M, 1x 75 cycle single-end; Illumina).
-
bioRxiv - Cell Biology 2022Quote: ... RNA library was constructed with 10x-Genomics Single Cell 3’ RNA sequencing kit v3 as previously described(18) sequenced using a NextSeq500 (Illumina). Cell clusters were characterized using an automated annotation tool(19 ...
-
Patient-associated mutations in Drosophila Alk perturb neuronal differentiation and promote survivalbioRxiv - Cancer Biology 2022Quote: ... and libraries prepared using the normal workflow for Single Cell 3’ v3 libraries (10X Genomics) and sequenced on the NextSeq 500 platform (Illumina). Initial preprocessing of scRNA-seq datasets began with demultiplexing ...
-
bioRxiv - Cell Biology 2022Quote: ... The libraries were pooled at equimolar concentrations and diluted prior to loading onto a P3 flow-cell (Illumina; Part # 20027800) with the P3 300 Cycle reagent kit (Illumina ...
-
bioRxiv - Developmental Biology 2021Quote: ... and cDNA synthesis and library construction were performed as per the manufacturer’s protocol for the Chromium Single Cell 3′ v2 protocol (10x Genomics; PN-120233) and sequenced on an Hiseq4000 (Illumina). 10x CellRanger (version 3.0.2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Libraries were generated using Kapa Biosystems library preparation kit (#KK8201) and multiplexed libraries were sequenced on a 1×75 flow cell on the HiSeq2000 platform (Illumina). Reads were filtered and trimmed to remove adapter-derived or low-quality bases using Trimmomatic and checked again with FASTQC ...
-
bioRxiv - Developmental Biology 2020Quote: Pearson correlations were calculated among all genes across a catalog of 38 tissues/cell types derived from all three germ layers (16 Illumina BodyMap 2.0 tissues ...
-
bioRxiv - Molecular Biology 2020Quote: ... The resulting libraries were minimally amplified to enrich for fragments using adapters on both ends and then quantified for sequencing at eight samples/flow cell by using a NextSeq 500/550 (Illumina) sequencer (PE 150).
-
bioRxiv - Neuroscience 2021Quote: ... Libraries were then pooled and sequenced in 18 runs with the NextSeq 500 using the high output flow cell (Illumina), pooling 3,000 to 12,000 cells per sequencing run ...
-
bioRxiv - Cancer Biology 2020Quote: ... Single cell barcoded cDNA libraries were quantified by quantitative PCR (Kappa Biosystems) and sequenced on an Illumina NextSeq 500 (Illumina). Read lengths were 26 bp for read 1 ...
-
bioRxiv - Cancer Biology 2021Quote: Barcoded RNA libraries were prepared starting with 1ug for MCF-10A and 500ng for HCC1806 cell lines of total RNA using the TrueSeq stranded mRNA kit with polyA selection (Illumina), and quantified using a Bioanalyzer DNA 1000 chip (Agilent) ...
-
bioRxiv - Developmental Biology 2022Quote: ... the “mkfastq” module of Cell Ranger was used to produce FASTQ files with raw base call (BCL) files as input generated by Illumina sequencer alignment.
-
bioRxiv - Immunology 2022Quote: ... Single-cell libraries were pooled together and sequenced single-end 50 bp on a single lane of a HiSeq4000 (Illumina). All results related to scRNA-seq are based on 4 pooled biological replicates per group.
-
bioRxiv - Plant Biology 2022Quote: Two libraries of 96 cells isolated with the BioSorter were sequenced on a HiSeqX and two libraries of 96 cells isolated with the Hana were sequenced on a NovoSeq (Illumina) at Novogene Co ...
-
bioRxiv - Cancer Biology 2022Quote: ... ScRNA-seq libraries were prepared using the Next GEM Chromium single cell 3′ reagent kits V3.1 with feature barcode technology for cell surface protein (10x genomics) and sequenced using NextSeq 500 high output kits and Novaseq S4 PE100 kits (Illumina). scRNA-Seq data after standard quality control was aligned to the reference genome (mm10 ...
-
bioRxiv - Cell Biology 2019Quote: ... Libraries were barcoded and sequenced on a NextSeq Series Sequencing System (HUJI Center for Genomic Technologies) using Illumina flow cell (Illumina 500 NextSeq High Output v2 Kit ...
-
bioRxiv - Immunology 2020Quote: ... Libraries were pooled and sequenced using the recommended 10X protocol for Illumina on the Mid Output flow cell for NextSeq 500 (Illumina).
-
bioRxiv - Molecular Biology 2020Quote: Small RNAs from Aag2 cells (input) or PIWI immunoprecipitations were cloned with the TruSeq small RNA sample preparation kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... nuclei were extracted from 50,000 cells per sample and chromatin was tagmented using the TDE1 transposase provided in the Nextera DNA Library Preparation Kit (Illumina). While the original protocol recommended 2.5µL of enzyme ...
-
bioRxiv - Genomics 2019Quote: ... Control and NF-YA KD cells were used as input material for the TruSeq Ribo Profile Mammalian Library Prep Kit (Illumina) following the manufacture’s protocol.
-
bioRxiv - Genomics 2019Quote: Single cell calling card library preparation was performed using the Nextera Mate Pair Sample Prep Kit (Illumina #FC-132-1001) with modifications to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... the post-PCR whole transcriptome amplification (WTA) products from each single cell were transformed into sequencing libraries using a Nextera XT kit (Illumina) and unique 8-bp DNA barcodes ...
-
bioRxiv - Neuroscience 2020Quote: ... Libraries were multiplexed on two high-output flow cells and sequenced (75 bp reads) on a NextSeq 500 device (Illumina). The mean ± standard deviation number of reads per sample meeting the Illumina quality criterion was 23 ± 6 million.
-
bioRxiv - Immunology 2021Quote: ... The cDNA was enriched for V(D)J cDNA using the Human B cell Chromium Single Cell V(D)J Enrichment Kit (Cat#1000016) followed by library construction to add the priming sites used by Illumina sequencers ...
-
bioRxiv - Immunology 2020Quote: ... and sequenced across 75 base pairs (bp) using a paired-end strategy with a 150-cycle high-output flow cell on a NextSeq 550 (Illumina). Three biological replicates were sequenced per experiment ...