Labshake search
Citations for Illumina :
151 - 200 of 328 citations for SARS Coronavirus Spike Glycoprotein S2 Mosaic C Term E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Final sequencing pools were loaded at 12pM concentration onto an Illumina MiSeq 300 cycle sequencing run with a 1% PhiX spike-in (Illumina).
-
bioRxiv - Cell Biology 2021Quote: ... and a 4 nM library was prepared for sequencing with a 50% spike in of PhiX Control DNA and the MiSeq Reagent Kit v2 (all from Illumina). Libraries were sequenced in 250 bp paired-end mode on an Illumina MiSeq Benchtop Sequencer ...
-
bioRxiv - Microbiology 2021Quote: ... a PhiX spike-in of 2.5-5% was added to the pools (PhiX Sequencing Control v3; Illumina # FC-110-3001). Samples were run on the Illumina NextSeq 500 ...
-
bioRxiv - Neuroscience 2021Quote: ... An equimolar pool of each librarie was prepared and loaded at 10 pM (with 25% PhiX spike in for generating sequencing diversity) for a 150 cycle paired-end run on a MiSeq instrument (Illumina) using a v2 reagent kit ...
-
bioRxiv - Microbiology 2022Quote: ... The viral spike sequences were verified using unbiased NGS sequencing (KAPA HyperPrep library kit with RiboErase, followed by Illumina sequencing). All cells and virus stocks tested negative for mycoplasma using MycoAlert Plus reagents (Lonza) ...
-
bioRxiv - Microbiology 2022Quote: ... a PhiX spike-in of 2.5–5% was added to the pools (PhiX sequencing control v3; Illumina FC-110-3001). Samples were run on the Illumina NovaSeq 6000 platform (single-read 1 ×85 cycles and 6 × i7 index cycles).
-
bioRxiv - Genomics 2020Quote: ... and pooled in equal concentrations prior to MiSeq v3 sequencing with 15% phiX control spike-in (Illumina FC-110-3001).
-
bioRxiv - Molecular Biology 2021Quote: ... SmRNA libraries were prepared as described above using 800 ng of RNA containing 40 ng Drosophila melanogaster RNA as spike-in and sequenced with the Novaseq 6000 system (Illumina) to 40 – 90 million reads per sample.
-
bioRxiv - Genetics 2021Quote: ... The bone and reference captured library pools were diluted to 1 pM with a 5% spike-in of PhiX Control V3 (Illumina) for sequencing on a NextSeq 550 (Illumina ...
-
bioRxiv - Neuroscience 2021Quote: ... Pooled sequencing libraries were loaded at a concentration of 1.8pM with 10% PhiX spike-in and sequenced using eight Illumina NextSeq 150 Cycle Hi-Output v2.5 kits (Illumina #20024907) on an Illumina NextSeq 550 System ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting 10 nM pool was denatured to 10 pmol with 5% PhiX spike-in and sequenced as single-read on HiSeq 2500 (Illumina) in rapid mode for 51 cycles (plus 7 cycles index read ...
-
bioRxiv - Genomics 2019Quote: ... single-end mode) at 12 pM loading concentration with 10% PhiX spike-in (PhiX Control V3 [Illumina FC-110-3001]) following the manufacturer’s instructions.
-
bioRxiv - Genomics 2019Quote: ... single-end mode) at 1.8 pM loading concentration with 2.5% PhiX spike-in (PhiX Control V3 [Illumina FC-110-3001]) following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2022Quote: ... Libraries were pooled from different samples based on molar concentrations and sequenced with 1% PhiX spike-in on a NextSeq 500 instrument (Illumina) with 33 bases each for read 1 and read 2 ...
-
bioRxiv - Genomics 2022Quote: ... Illumina) following the Illumina recommended denaturation and loading recommendations which included a 1% PhiX spike in (PhiX Control v3 Illumina). Data was uploaded to Basespace (www.basespace.illumina.com ...
-
bioRxiv - Microbiology 2023Quote: ... a PhiX spike-in of 2.5–5% was added to the pools (PhiX sequencing control v3; Illumina FC-110- 3001). Samples were run on the Illumina NovaSeq 6000 platform (single-read 1 ×85 cycles and 6 × i7 index cycles).
-
bioRxiv - Immunology 2023Quote: ... all indexed libraries were pooled with 6% PhiX spike-in DNA and sequenced using a MiSeq Reagent Nano Kit v2 (500 cycles) (Illumina) at the Fralin Genomics Sequencing Center.
-
bioRxiv - Bioengineering 2023Quote: ... Library was sequenced on an Illumina MiSeq instrument using Illumina MiSeq Reagent Kit v2 Micro (300-cycles) with 50% PhiX spike-in (Illumina). After demultiplexing ...
-
bioRxiv - Genetics 2023Quote: ... Samples were pooled prior to sequencing with a 25% spike-in of PhiX and run on a NovaSeq 6000 S4 flow cell from Illumina to generate 150 bp paired-end reads ...
-
bioRxiv - Microbiology 2023Quote: ... All sequencing runs were performed with a spike-in of 1% PhiX control library V3 (Illumina, Cat. FC-110-3001). The sequencing mean library size was 134,629,540.5 reads [range ...
-
bioRxiv - Molecular Biology 2024Quote: ... and clustered on an Illumina Novaseq 6000 S4 flow cell followed by 150bp paired-end sequencing with inclusion of 10-15% spike-in PhiX Control v3 library (Illumina). Controlled access to DNase-seq ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli transposition assays were mixed with 5 µL of tagmentation DNA buffer (Illumina) and 1 µL of amplicon tagmentation mix (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... region was amplified using the primer set (16S-341F/805R, see Table S2 for nucleotide sequences) according to the 16S Metagenomic Sequencing Library Preparation procedure (Illumina; San Diego, CA). The success of PCR amplification was confirmed using agarose electrophoresis (1.5%) ...
-
bioRxiv - Microbiology 2023Quote: ... Resulting libraries were sequenced as 28/10/10/50 base reads on the NovaSeq instrument using the S2 Reagent kit in paired-end mode (Illumina, San Diego, CA). Fastq files were processed with Spaceranger-1.4.2 pipeline ...
-
bioRxiv - Microbiology 2019Quote: ... Illumina recommended denaturation and loading recommendations which included a 1% PhiX spike in (PhiX Control v3 Illumina Catalogue FC-110-3001). Whole genome sequencing data has been deposited in the Sequence Read Archive under PRJNA529870.
-
bioRxiv - Microbiology 2020Quote: ... ChIP-seq libraries were sequenced on the Illumina NextSeq 500 system with a 20% phiX spike-in (Illumina, FC-110-3001) to generate 75 bp single-end reads (NextSeq 500/550 High Output v2 kit) ...
-
bioRxiv - Genomics 2019Quote: ... paired-end mode with R1 67 and R2 8) at 1.8 pM loading concentration with 2.5% PhiX spike-in (PhiX Control V3 [Illumina FC-110-3001]) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... C and D (Illumina). Amplicon concentration across samples was normalized to 200 ng/μl using the Qubit high sensitivity dsDNA assay before pooling ...
-
bioRxiv - Molecular Biology 2021Quote: ... coli control sample was rRNA depleted using the RiboZero for bacteria kit (Illumina, USA). 100 ng of two replicates each of AbmR co-purified RNA and rRNA-depleted induced E.coli control RNA were converted into RNA-seq libraries using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs ...
-
bioRxiv - Genomics 2021Quote: ... 2 × 150 bp reads for each parent were generated on an Illumina NovaSeq 6000 instrument using the NovaSeq S2 reagent kit (Illumina, San Diego, California, USA). A total of 539,570,835 reads for the N ...
-
bioRxiv - Genomics 2021Quote: ... and 2 × 150 bp reads were produced on an Illumina NovaSeq 6000 instrument using the NovaSeq S2 reagent kit (Illumina, San Diego, California, USA). An average of 57,521,215 reads were generated for each of the 4 samples ...
-
bioRxiv - Microbiology 2024Quote: ... The final co-culture RNA-sequencing library (fig. S20B) was deep-sequenced on a NovaSeq 6000 instrument with a 100 cycles S2 Kit (Illumina, San Diego, CA, USA) in paired-end mode (Read 1 ...
-
bioRxiv - Microbiology 2020Quote: ... At Gdansk two independent protocols were used for SARS-CoV-2 genome sequencing: Illumina RNA prep with enrichment for respiratory virus oligos panel V2 followed by Illumina MiniSeq medium output run that produced 150-nucleotide paired-end reads ...
-
bioRxiv - Systems Biology 2019Quote: ... denatured in NaOH and combined with HT1 plus a 1% PhiX spike at a final running concentration of 10pM.The flow-cell was clustered using HiSeq PE Cluster Kit v3 (Illumina, PE-401-3001) utilising the Illumina PE HiSeq Cluster Kit V3 cBot recipe V8.0 method on the Illumina cBot ...
-
bioRxiv - Genomics 2020Quote: ... 10 pM DNA library was prepared under Denature and Dilute Libraries Guide of Illumine MiSeq System with 15% PhiX spike-in control (Illumina, CA, USA) and eventually subjected to 250 bp pair-end sequencing on a MiSeq lane (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were multiplexed and sequenced with a 15% spike-in of PhiX DNA in an Illumina NovaSeq platform (Illumina, San Diego, CA) using a 200 cycle single-end read at the same facility ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... trim regions with average quality scores below Q10 from both ends of reads and to filter out reads aligning to PhiX-174 genome (a commonly used spike-in control in Illumina sequencing runs). After filtering ...
-
bioRxiv - Genomics 2019Quote: ... libraries were prepared according to the manufacturer’s instructions with a 1% spike-in of the ϕX174 control library (Illumina #FC-110-3002) and sequenced on an Illumina NextSeq 500 instrument with a High Output v2 reagent kit (Illumina #FC-404-2005) ...
-
bioRxiv - Genomics 2021Quote: ... using the Illumina TruSeq mRNA library preparation protocol (poly-A selected) (Illumina; Part: 15031047 Revision E). mRNA-Seq libraries were sequenced on an Illumina NovaSeq 6000 platform to generate >66 M paired end reads per sample (Min ...
-
bioRxiv - Immunology 2021Quote: ... Libraries were prepared following 10X Genomics protocols (Chromium Single Cell 3’ Reagent Kits v2 Chemistry) and sequenced on NovaSeq 6000 (Illumina S2 flow cell, paired-end). FASTQ files were processed using cellranger (https://support.10xgenomics.com/single-cell-gene-expression/software/pipelines/latest/what-is-cell-ranger ...
-
bioRxiv - Genetics 2021Quote: A custom genotyping microarray for selected feline disease and trait associated variants (S2 Table) was developed based on the robust and widely utilized Illumina Infinium XT platform (Illumina, Inc., San Diego, CA, USA), commercially available as the Complete for Cats™ / MyCatDNA™ / Optimal Selection™ Feline tests ...
-
bioRxiv - Molecular Biology 2022Quote: ... Bulk and STORM-seq K562 libraries were pooled and 2×50 bp sequencing was performed on an Illumina NovaSeq 6000 sequencer using a 100 bp S2 sequencing kit (Illumina Inc., San Diego, CA, USA). The HEK293T ...
-
bioRxiv - Immunology 2022Quote: ... a multiplexed amplicon-based whole-viral-genome approach using the NEBNext® ARTIC SARS-CoV-2 Library Prep Kit (Illumina®) was employed (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... Library preparation of amplified SARS-CoV-2 DNA for sequencing was performed using a Nextera XT library prep kit (Illumina Inc.) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Library preparation of amplified SARS-CoV-2 DNA for sequencing was performed using a Nextera XT library prep kit (Illumina Inc.) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... DNA fragments of the SARS CoV-2 genome were hybridized with biotinylated respiratory virus oligos (Illumina Inc., San Diego, CA, USA). The DNA fragments hybridized with the custom oligos were captured using streptavidin magnetic beads ...
-
bioRxiv - Genomics 2020Quote: Messenger RNA capture based libraries were prepared starting from 8.5 µL DNase treated and spike-in supplemented RNA eluate using the TruSeq RNA Exome Library Prep Kit (Illumina, San Diego, CA, USA). Each sample underwent individual enrichment according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... libraries were prepared according to the manufacturer’s instructions with a 1% ϕX174 spike-in and sequenced on an Illumina MiSeq instrument with a Reagent Kit v3 (Illumina #MS-102-3001), reading 169 nt for read 1 and 6 nt for the P7 index read.
-
bioRxiv - Cancer Biology 2020Quote: ... and sequenced on Illumina next-generation sequencing platforms with a 20% spike-in of PhiX control DNA (Illumina, cat. no. FC-110-3001). All sequencing runs used a dual-index configuration and a custom Read 1 primer (5’ GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAG 3’ ...
-
bioRxiv - Microbiology 2022Quote: ... Purified libraries were sequenced on Illumina MiSeq platform (reagent kits: v2 300-cycles, paired-end mode) at 8 pM loading concentration with 25% PhiX spike-in (Illumina FC-110-3001). Custom sequencing primers were spiked into reagent cartridge (well 12 ...