Labshake search
Citations for Illumina :
151 - 200 of 495 citations for LAG 3 Human HEK293 mFc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... after first removing the host rRNA with a Ribo-Zero-Gold (Human–Mouse–Rat) kit (Illumina). Each library was sequenced as 100-bp paired-ends on the Novaseq 6000 S4 platform (Illumina).
-
bioRxiv - Developmental Biology 2022Quote: Since the human epidemiological cohort data were generated on a different genomic platform (Illumina 450K array), we developed an imputation scheme for converting measurements between the two platforms ...
-
Coding and non-coding drivers of mantle cell lymphoma identified through exome and genome sequencingbioRxiv - Genomics 2019Quote: ... we used the Agilent SureSelect Human All Exon kits for library preparation and HiSeq2000 instruments (Illumina) for sequencing ...
-
bioRxiv - Immunology 2019Quote: ... Hybridization of the cRNA was performed on an Illumina Human-HT12 Version 4 chip set (Illumina). Microrarray data were exported from GenomeStudio (Illumina ...
-
bioRxiv - Genetics 2019Quote: ... The sample was genotyped on the Illumina Human Core Exome Array (Illumina, San Diego, CA, US). GWAS QC was performed using standard methods and imputation was done using the HRC panel [63] on the Sanger Imputation server (https://imputation.sanger.ac.uk/) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... DNA methylation was quantified using Infinium® Human Methylation 450K BeadChip (Illumina Inc.; San Diego, CA).
-
bioRxiv - Molecular Biology 2020Quote: ... Obtained RNA was depleted of rRNAs with Ribo-Zero Gold Kit (Human/Mouse/Rat) kit (Illumina), separated in 17% Urea gel and stained with SYBR Gold (Invitrogen) ...
-
bioRxiv - Pathology 2021Quote: ... Ribosomal RNA depletion was carried out solely using the RiboZero Gold Human/Mouse/Rat kit (Illumina). Adapter sequences were based on the TruSeq small RNA sequences (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA sequencing was performed at BCM Human Genome Sequencing Center using NovaSeq 6000 platform (Illumina). The raw fastq files were first quality checked using FastQC v0.11.8 software (http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/) ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA depletion was conducted with the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) for human and mouse samples and with Caenorhabditis elegans Ribo-Seq riboPOOLs (siTOOLs Biotech ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA depletion was performed with the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, accompanied by TruSeq Stranded Total RNA Kit) ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA depletion was conducted by the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, accompanied by TruSeq Stranded Total RNA Kit) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genome-wide DNA methylation was analysed on 850000 CpGs with the Infinium Human MethylationEPIC Kit (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2024Quote: ... 1 µg of DNAse-treated RNA was treated with RiboZero Gold (Human/Mouse/Rat) kit (Illumina) to remove rRNAs ...
-
bioRxiv - Genomics 2024Quote: ... combined with methylation data collected from the public TCGA LUAD study (Illumina Human Methylation 450k BeadChip) (Supplementary Table 1) ...
-
bioRxiv - Genomics 2024Quote: Human islet RNA-seq libraries were prepared from total RNA using the stranded TruSeq kit (Illumina). ERCC Mix 1 or Mix 2 spike-ins were randomly added to each sample (Thermo Fisher ...
-
bioRxiv - Bioengineering 2024Quote: The compressed paired-end human mRNA-seq data in fastq format over 80 gigabytes from Illumina PE150 ...
-
bioRxiv - Molecular Biology 2024Quote: ... we used the 318 curated files containing raw human blood expression data (FASTQ containing Illumina reads) of the Bgee project (see supplementary data of (Bastian et al ...
-
bioRxiv - Neuroscience 2021Quote: ... The blunt-ended double-stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Cell Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Genomics 2019Quote: ... 1 μg DNA aliquots (n=3) were processed for 850K Infinium MethylationEPIC Array (Illumina) as previously described43 ...
-
bioRxiv - Genomics 2021Quote: For each sample sequenced in 3 separate experiments (CoronaHiT-ONT, CoronaHiT-Illumina, ARTIC-ONT), a phylogeny was generated from all of the consensus genomes (n=216 for the routine samples and n=132 for the rapid response samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end sequencing was performed using TruSeq 3000 4000 SBS Kit v.3 (Illumina) on the HiSeq 4000 platform (11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... which was prepared with the QuantSeq 3’ mRNA-Seq Library Prep Kit from Illumina following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Molecular Biology 2021Quote: ... ribosomal RNAs were removed by a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, RZG1224). Then ...
-
bioRxiv - Genomics 2020Quote: ... microRNA expression profiling was performed using the human v2.0 microRNA Expression BeadChip (Illumina, Inc., San Diego, Calif) with 1146 microRNAs covering 97% of the miRBase 12.0 database according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2020Quote: ... Total RNA was depleted from ribosomal RNA using Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat, Illumina) followed by cDNA library preparation as described below.
-
bioRxiv - Neuroscience 2022Quote: ... All samples were depleted of ribosomal RNA using the Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina) (replicates 1-3 and cycloheximide treated ...
-
bioRxiv - Genetics 2022Quote: ... Libraries were prepared using the Agilent SureSelect XT Human All Exon + UTR (v8) kit followed by Illumina NovaSeq 6000 150 cycle paired end sequencing ...
-
bioRxiv - Molecular Biology 2019Quote: ... mRNA expression levels were extracted from microarray analyses performed on a Human HT-12-v4 BeadChip (Illumina) after labeling (Ambion ...
-
bioRxiv - Microbiology 2021Quote: ... Host ribosomal depletion was performed using a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina). Paired-end transcriptome sequencing was generated on the HiSeq2500 platform (Illumina).
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA samples were treated with a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) and used for RNA-Seq library preparation using an Illumina TruSeq Stranded Total RNA Library Prep Kit (Illumina ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina single indexed adapters (Illumina) were ligated ...
-
bioRxiv - Microbiology 2020Quote: ... 3’ adapter sequences from the Illumina TruSeq Small RNA Library Preparation Kit (Illumina, RS-200) were ligated onto the dsRNA species by mixing together 1 μl of adapter with 1 μg dsRNA in a 6 μl reaction and heated at 70°C for 2 minutes ...
-
bioRxiv - Genomics 2022Quote: ... An “A” base was then added to the 3’ end and the adaptor from Illumina was ligated only to one end of the resultant dsDNA as the other end contained a 5’ overhang introduced by the N9 primer ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by A-tailing and ligation at the 3’ ends with paired-end adaptors (Illumina) with a single “T” base overhang ...
-
bioRxiv - Cancer Biology 2021Quote: Four 3’ PCR primers were used each containing a unique index (underlined) recognized by Illumina:
-
bioRxiv - Synthetic Biology 2022Quote: ... adding barcodes to identify the sample (primers P3-P15 in Supplementary Table 3, containing Illumina Nextera tagmentation adapters and ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Biochemistry 2023Quote: ... mRNA libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina). Quality of mRNA libraries was determined using Agilent Tape Station and mRNA was sequenced at 75 bp single read sequencing using NextSeq 500 (Illumina).
-
bioRxiv - Genetics 2021Quote: ... and iPSC-derived neural progenitor cells (NPC-FGF) was assessed using the Infinium Human Methylation EPIC BeadChip (Illumina), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples that met the Illumina TruSeq Stranded Total RNA (Human/Mouse/Rat) (Illumina Inc., San Diego, CA,USA) sample input guidelines were prepared according to the kits protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reads were confirmed to be post-quality control by Prinseq and mapped to the human donor sequence (hCoV-19/Germany/BavPat1/2020|EPI_ISL_406862|2020-01-28) using BWA (Illumina) and Pomoxis mini_align (Minion) ...
-
bioRxiv - Neuroscience 2019Quote: ... 332 cells from eight adult human brains (three males and five females) were collected and profiled by Illumina MiSeq and Illumina NextSeq 500 ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNAseq-based gene expression and methylation array data (either Illumina human methylation27K array, n = 15 genomes; or Illumina human methylation450K array ...
-
bioRxiv - Genomics 2022Quote: ... the samples were applied following the Illumina Infinium Human Methylation DNA chip manufacturer protocols (Illumina, San Diego, CA). Chips were analyzed using the Illumina Hi-Scan system at the McDonnell Genome Institute (MGI ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 μg of total RNA were treated with the Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat; Illumina). Depleted RNA was precipitated 1h at −80°C in three volumes of ethanol plus 1 μg of glycogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total RNA was depleted of ribosomal RNA using Ribo-Zero rRNA Removal Kit (Epicentre/Illumina, Human/Mouse/Rat) and library preparation was completed using NEBNext® Ultra Directional RNA Library Prep Kit for Illumina® (New England Biolabs) ...