Labshake search
Citations for Illumina :
151 - 200 of 8914 citations for Human Lysine K Specific Demethylase 1A KDM1A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... after first removing the host rRNA with a Ribo-Zero-Gold (Human–Mouse–Rat) kit (Illumina). Each library was sequenced as 100-bp paired-ends on the Novaseq 6000 S4 platform (Illumina).
-
Coding and non-coding drivers of mantle cell lymphoma identified through exome and genome sequencingbioRxiv - Genomics 2019Quote: ... we used the Agilent SureSelect Human All Exon kits for library preparation and HiSeq2000 instruments (Illumina) for sequencing ...
-
bioRxiv - Pathology 2021Quote: ... Ribosomal RNA depletion was carried out solely using the RiboZero Gold Human/Mouse/Rat kit (Illumina). Adapter sequences were based on the TruSeq small RNA sequences (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA depletion was conducted with the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) for human and mouse samples and with Caenorhabditis elegans Ribo-Seq riboPOOLs (siTOOLs Biotech ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA depletion was performed with the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, accompanied by TruSeq Stranded Total RNA Kit) ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA depletion was conducted by the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, accompanied by TruSeq Stranded Total RNA Kit) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genome-wide DNA methylation was analysed on 850000 CpGs with the Infinium Human MethylationEPIC Kit (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2024Quote: Human islet RNA-seq libraries were prepared from total RNA using the stranded TruSeq kit (Illumina). ERCC Mix 1 or Mix 2 spike-ins were randomly added to each sample (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 µg of DNAse-treated RNA was treated with RiboZero Gold (Human/Mouse/Rat) kit (Illumina) to remove rRNAs ...
-
bioRxiv - Systems Biology 2020Quote: ... was used to perform automated preparation of strand-specific RNA-seq libraries using the TruSeq Stranded Total RNA with Ribo-Zero Gold kit (cat# RS-122-2393, Illumina, San Diego, CA, USA). According to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: Strand-specific RNA-sequencing (ssRNA-seq) libraries were prepared using the illumina Truseq Stranded mRNA Sample Preparation Kit (Illumina, catalogue number RS-122-2101) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... was adjusted to 1 μg and used for poly (A) mRNA enrichment and stranded specific RNA-Seq library preparation with TruSeq Stranded mRNA kit (Illumina, San Diego, CA, USA). Quality control of prepared libraries were performed using Agilent Bioanalyzer DNA 1000 kit and Qubit DNA HS fluorescence kit ...
-
bioRxiv - Cancer Biology 2020Quote: ... Strand specific RNA-seq libraries were constructed using the Illumina TruSeq Stranded Total RNA Library preparation Gold kit (20020598, Illumina Inc., San Diego, CA) as per the instructions ...
-
bioRxiv - Genomics 2020Quote: ... Following sequencing of strand-specific libraries on a HiSeq4000 platform (Illumina), raw reads were mapped to the human reference genome (hg19) ...
-
bioRxiv - Neuroscience 2020Quote: ... the Nextera indices (12 pool-specific indices, Illumina, FC-131-2001) and 10 µM P5-TSO hybrid primer (5’-AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCA ACGCAGAGT*A*C-3’ ...
-
bioRxiv - Molecular Biology 2021Quote: ... ribosomal RNAs were removed by a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, RZG1224). Then ...
-
bioRxiv - Genomics 2020Quote: ... Total RNA was depleted from ribosomal RNA using Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat, Illumina) followed by cDNA library preparation as described below.
-
bioRxiv - Neuroscience 2022Quote: ... All samples were depleted of ribosomal RNA using the Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina) (replicates 1-3 and cycloheximide treated ...
-
bioRxiv - Genetics 2022Quote: ... Libraries were prepared using the Agilent SureSelect XT Human All Exon + UTR (v8) kit followed by Illumina NovaSeq 6000 150 cycle paired end sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... Host ribosomal depletion was performed using a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina). Paired-end transcriptome sequencing was generated on the HiSeq2500 platform (Illumina).
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA samples were treated with a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) and used for RNA-Seq library preparation using an Illumina TruSeq Stranded Total RNA Library Prep Kit (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... The rRNA-depleted RNA was then used to generate strand-specific RNA-seq libraries using TruSeq® Stranded mRNA Kit (Illumina, San Diego, CA, USA). In total ...
-
bioRxiv - Genomics 2021Quote: ... and a similar k-mer distribution pattern to GenomeScope2 (performed with Illumina PE reads). Additionally ...
-
bioRxiv - Genomics 2020Quote: ... Fragments were amplified with 12–18 cycles using adaptor specific primers (Illumina); fragments ranging between 300 and 500⍰bp in size were gel-purified before cluster generation and sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... with short-read strand-specific library prep with poly A enrichment (Illumina). Paired-end reads were filtered to remove low-quality reads (Q <5 ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 μg of total RNA were treated with the Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat; Illumina). Depleted RNA was precipitated 1h at −80°C in three volumes of ethanol plus 1 μg of glycogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total RNA was depleted of ribosomal RNA using Ribo-Zero rRNA Removal Kit (Epicentre/Illumina, Human/Mouse/Rat) and library preparation was completed using NEBNext® Ultra Directional RNA Library Prep Kit for Illumina® (New England Biolabs) ...
-
bioRxiv - Neuroscience 2021Quote: Analysis of pluripotency gene expression profile was performed using the Human-HT-12-v4 expression BeadChip Kit (Illumina) and subsequent Pluritest analysis ...
-
bioRxiv - Molecular Biology 2021Quote: ... and stranded total RNA libraries were prepared using the TruSeq Stranded Total RNA Human/Mouse/Rat kit (Illumina), following manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Ribosomal RNA was removed from total RNA using the Ribo Zero Gold for human/mouse/rat kit (Illumina). Using the TruSeq RNA Sample Library Preparation v.2 kit (Illumina) ...
-
bioRxiv - Genomics 2023Quote: ... and stranded total RNA libraries were prepared using the TruSeq Stranded Total RNA Human/Mouse/Rat kit (Illumina), following manufacturer’s instructions.
-
bioRxiv - Genomics 2020Quote: A total of 720 metagenomic libraries were prepared using Illumina-specific Nextera DNA transposase adapters and a Tagment DNA Enzyme and Buffer Kit (Illumina, San Diego, CA, cat. no. 20034197) (modified from Baym et al ...
-
bioRxiv - Genomics 2023Quote: Genome size was estimated by K-mer (17-mer) analysis using reads generated by Illumina Hiseq sequencing according to Lander-waterman theory ...
-
bioRxiv - Neuroscience 2021Quote: ... Libraries were prepared using the TruSeq strand-specific mRNA sample preparation system (Illumina). The final library was generated by further purification and amplification with PCR ...
-
bioRxiv - Genomics 2020Quote: ... libraries were normalized on specific beads according to the Nextera XT protocol (Illumina). Normalized libraries were pooled into a single library for sequencing on MiSeq ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... fusion primers (i.e. containing partial adapters sequences specific of respectively Illumina or ONT) were used for the first PCR ...
-
bioRxiv - Microbiology 2019Quote: ... strand-specific cDNA libraries were prepared and sequenced on an HiSeq platform (Illumina) with paired-end 150bp assay ...
-
bioRxiv - Genetics 2020Quote: ... RNA-seq libraries of strand-specific paired-end reads were sequenced by Illumina HiSeq 2000 ...
-
bioRxiv - Genetics 2020Quote: ... Genes found to be L5-specific (present in completed PacBio and Illumina genomes) were also checked for SNPs in these genes using each of the L5 completed PacBio genomes as a reference ...
-
bioRxiv - Molecular Biology 2020Quote: RNA (2.5 μg) was processed using rRNA depletion beads specific to yeast (Illumina). Bar-coded sequencing libraries were prepared as recommended by the manufacturer (TruSeq Stranded Total RNA Library Preparation Kit ...
-
bioRxiv - Cell Biology 2023Quote: ... Individual libraries were pooled with specific index sequences and then sequenced by Illumina Next Seq 500 platform (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... strand-specific sequencing platform was used on Illumina NextSeq 500 (Illumina, CA, USA) with a read length of 75 bp.
-
bioRxiv - Genomics 2023Quote: ... Tissue-specific libraries were sequenced PE150 on two lanes of NovaSeq 6000 (Illumina) (table S1) ...
-
bioRxiv - Molecular Biology 2024Quote: ... QHR-4C libraries were constructed with specific primer pairs (forward primers containing Illumina P5 with sequences near a specific viewpoint and reverse primers containing Illumina P7 with an index and sequences matching the adapter ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human/Mouse/Rat (Illumina, discontinued), and fragmented by incubating with PNK buffer (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA library construction using TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Human (Illumina #RS-122-2201) and sequencing on an Illumina NovaSeq6000 platform was performed by Macrogen (Tokyo ...
-
bioRxiv - Genomics 2019Quote: ... followed by the removal of ribosomal RNA using a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina). Strand-specific sequencing libraries were prepared using a NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Genomics 2019Quote: ... RNA sequencing libraries were made using the TruSeq Stranded Total RNA with Ribo-Zero Human/Mouse/Rat kit (Illumina) according to manufacturer instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The RNA- Seq library was prepared by the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, RZG1224) and TruSeq Stranded mRNA Library Prep Kit (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... Ribosomal reduction libraries were prepared with the Ribo-Zero Gold rRNA removal kit (human/mouse/rat) MRZG12324 (Illumina, USA) and sequenced at the Yale University Center of Genome Analysis (YCGA ...