Labshake search
Citations for Illumina :
151 - 200 of 527 citations for 6 chloro 9H 3 C methyl β D ribofuranosyl purine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... All of the 3′ and 5′ flowcells were demultiplexed with bcl2fastq (Illumina). FASTQ files were processed with Cell Ranger v7.0.1 (10x Genomics) ...
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Microbiology 2023Quote: ... or matched the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Microbiology 2023Quote: ... or matching the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Genetics 2023Quote: ... The final constructed 3’-biased single cell libraries were sequenced by Illumina Novaseq6000 machine ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries 1-3 (wild type) were sequenced on a NovaSeq 6000 (Illumina) and the mutant library was sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... distributed over 3 lanes of a HiSeq 2500 with v4 chemistry (Illumina). Sequencing was performed by the Next Generation Sequencing Facility at Vienna BioCenter Core Facilities (VBCF) ...
-
bioRxiv - Immunology 2022Quote: ... All BCR enriched V(D)J libraries were pooled together and sequenced on a NextSeq500 (Illumina) using the same parameters as previously mentioned.
-
bioRxiv - Physiology 2021Quote: ... and the combination of 384 Unique Dual Indexes (Illumina-Set A to D, Ref. 20027213-20027216). Using the Mosquito HV robot ...
-
bioRxiv - Genetics 2019Quote: Genotype information was available for 21,001 NTR participants from 6 different genotyping arrays (Affymetrix 6.0 [N = 8,640], Perlegen-Affymetrix [N = 1,238], Illumina Human Quad Bead 660 [N = 1,439] ...
-
bioRxiv - Cell Biology 2023Quote: ... and 20 μM reverse P7 primers with 6-bp TruSeq indices that are automatically demultiplexed by Illumina software ...
-
bioRxiv - Developmental Biology 2022Quote: ... All 6 individual libraries were pooled in equal amount and sequenced with the HiSeq 4000 platoform (Illumina). The RNA-seq data are available under the GEO accession no ...
-
bioRxiv - Genomics 2019Quote: ... and the Hi-C libraries were paired-end sequenced (HiSeq 2500, Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... The pool was adjusted to 10pM for clustering on C-Bot (Illumina) and then sequenced Paired-End 101 bases using the HiSeq SBS Kit v4 (Illumina ...
-
bioRxiv - Systems Biology 2023Quote: ... 62 °C for 5 min) using Nextera i5/i7 indexing primers (Illumina) and 2x KAPA HiFi HotStart ready-mix (KAPA Biosystems) ...
-
bioRxiv - Cancer Biology 2020Quote: ... mRNA expression (RNA-Seq level 3 data) and DNA methylation (Illumina HumanMethylation450 array) data of 33 types of cancers (n=10,528 ...
-
bioRxiv - Genomics 2021Quote: ... Lab 3 sequenced DNA on a NextSeq 550 (Illumina, San Diego, CA, USA), paired-end 2×75 bp ...
-
bioRxiv - Molecular Biology 2020Quote: Create CSV files listing of all 3 sets of barcodes (Illumina, plate, well)
-
bioRxiv - Neuroscience 2023Quote: ... cDNA libraries were prepared using a 3′-Tag-RNA-Seq library kit (Illumina). Sequencing was performed using one lane of a Hi-Seq 4000 platform with pair-end 40 bp reads ...
-
bioRxiv - Genomics 2023Quote: ... and combined with PhiX control (v.3, Illumina Inc, San Diego, CA, USA) at a final concentration of 1% ...
-
bioRxiv - Pathology 2019Quote: ... Amplicons were then indexed using the Nextera XT Index Kit V2 set A and set D (Illumina) and purified again with AMPure XP beads to remove low molecular weight primers and primer-dimer sequences ...
-
bioRxiv - Immunology 2023Quote: ... V(D)J region-enriched libraries were pooled and sequenced using the NovaSeq 6000 Sequencing System (Illumina).
-
bioRxiv - Immunology 2023Quote: ... alpha/beta libraries were prepared on 100 ng of RNA from each sample using the SMARTer Mouse TCR α/β Profiling Kit from Takarabio® and sequenced using the MiSeq V2 2×150bp (Illumina®) and HiSeq2500 V2 2×150bp (Illumina® ...
-
bioRxiv - Cancer Biology 2019Quote: ... Bead-bound DNA was amplified with 6 PCR amplification cycles using PE PCR 1.0 and PE PCR 2.0 primers (Illumina). Primary samples T-ALL 2-5 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Up to 6 barcoded samples were pooled in one lane of the flow cell and sequenced by Illumina NextSeq 500 (MidOutput run) ...
-
bioRxiv - Systems Biology 2020Quote: ... Paired-end sequencing (75 cycles with a 6-cycle index read) was performed with the NextSeq 500 (Illumina) platform ...
-
bioRxiv - Cancer Biology 2021Quote: ... Micorarray transcriptional analysis was performed using the HumanWG-6 v3.0 expression BeadChip sytem (Illumina, San Diego, CA, USA) at the Wistar Genomics facility ...
-
bioRxiv - Cancer Biology 2020Quote: ... in paired-end mode on Illumina (2×101 bp) using TrueSeq DNA exome kit (v.6) (Illumina Inc.). Paired-end reads were aligned to the human reference genome sequence GRCh38 using BWA–MEM (V0.715-r1140 ...
-
bioRxiv - Genomics 2019Quote: ... and the Promoter CHi-C libraries were paired-end sequenced (HiSeq 2500, Illumina).
-
bioRxiv - Genomics 2021Quote: We downloaded publicly-available Hi-C data from human prefrontal cortex tissue23,24 (Illumina HiSeq 2000 paired-end raw sequence reads ...
-
bioRxiv - Genomics 2020Quote: ... Hi-C libraries were paired-end sequenced on a NovaSeq 6000 system (Illumina). Raw data were processed with the ENCODE 4 pipeline for Hi-C according to ENCODE 4 standards (https://www.encodeproject.org/documents/75926e4b-77aa-4959-8ca7-87efcba39d79/).
-
Dual symbiosis in the deep-sea hydrothermal vent snail Gigantopelta aegis revealed by its hologenomebioRxiv - Genomics 2020Quote: ... The Hi-C library was sequenced on a NovaSeq 6000 platform (Illumina, USA) and generated reads with a length of 150 bp ...
-
bioRxiv - Cancer Biology 2022Quote: ... Hi-C libraries were sequenced 2×150bp on a NovaSeq 6000 instrument (Illumina). Juicer were used to process raw reads and generate Hi-C contact matrices (.hic files) ...
-
bioRxiv - Genetics 2022Quote: ... the products from each sample were bulked and applied to c-Bot (Illumina) bridge PCR followed by sequencing on Illumina Hiseq2500 ...
-
bioRxiv - Plant Biology 2023Quote: ... Hi-C libraries were sequenced on Illumina NextSeq500 (Illumina, San Diego, CA, USA) platform using platform using High Output Kit v2.5 (150 Cycles).
-
bioRxiv - Genomics 2023Quote: ... The Hi-C library was sequenced on a NovaSeq 6000 platform (Illumina, USA) and generated reads with a length of 150 bp producing 32.08 Gbp of data in total (Supplementary Table 1) ...
-
bioRxiv - Systems Biology 2021Quote: ... ADT and V(D)J libraries were sequenced separately on a Next-seq platform (Illumina, San Diego, CA). The sequencing depths are shown in Table S2.
-
bioRxiv - Microbiology 2021Quote: ... The sequencing library was prepared using the Nextera XT V.2 Index Kit (Sets A and D, Illumina) according to the Illumina 16S MiSeq Sequencing Library protocol ...
-
bioRxiv - Genomics 2019Quote: ... RNAseq libraries were constructed using TruSeq Stranded mRNA SamplePrep Guide 150310 47 D protocol (Illumina®, California, U.S.A.). The RNAseq samples have been sequenced in single-end reads (SR ...
-
bioRxiv - Genomics 2021Quote: ... standard Nextera XT Index Kit indexes were used (Sets A to D for up to 384 combinations, Illumina Catalogue No’s FC-131-2001 ...
-
bioRxiv - Neuroscience 2021Quote: ... The blunt-ended double-stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Cell Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Genomics 2019Quote: ... 1 μg DNA aliquots (n=3) were processed for 850K Infinium MethylationEPIC Array (Illumina) as previously described43 ...
-
bioRxiv - Genomics 2021Quote: For each sample sequenced in 3 separate experiments (CoronaHiT-ONT, CoronaHiT-Illumina, ARTIC-ONT), a phylogeny was generated from all of the consensus genomes (n=216 for the routine samples and n=132 for the rapid response samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end sequencing was performed using TruSeq 3000 4000 SBS Kit v.3 (Illumina) on the HiSeq 4000 platform (11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... which was prepared with the QuantSeq 3’ mRNA-Seq Library Prep Kit from Illumina following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Developmental Biology 2022Quote: Transposed DNA fragments were purified using the Qiagen MinElute kit and amplified 6-8 cycles using the Nextera (Illumina) PCR primers ...
-
bioRxiv - Immunology 2020Quote: ... Libraries were sequenced on the iSeq (cases 1 - 6 and controls) or NovaSeq 6000 (case 7 and controls) (Illumina) using 150nt paired-end reads.