Labshake search
Citations for Illumina :
151 - 200 of 1631 citations for 2' Chloro 3 2 3 dimethylphenyl 4' fluoropropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... 10bp (Index i5) and 90bp (Read 2) (Illumina).
-
bioRxiv - Genetics 2024Quote: ... and sequencing (Illumina HiSeq 2 x 150 bp) of the control sample were completed by GENEWIZ (New Jersey ...
-
bioRxiv - Immunology 2022Quote: ... using MiSeq V3 2 × 300 cycle kit (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... Sequencing (Illumina HiSeq, paired-end, 2×125 bp) was performed by Eurofins Genomics (Ebersberg ...
-
bioRxiv - Neuroscience 2023Quote: ... 2×100 bases paired-end (Novaseq 6000, Illumina).
-
bioRxiv - Genomics 2023Quote: ... and Hi-C (Illumina NovaSeq 6000, 2×150bp) for chromosome-level scaffolding (Fig ...
-
bioRxiv - Microbiology 2024Quote: ... 2×150bp reads (20040534, Illumina, San Diego, CA). RNA sequencing was performed on a NovaSeq X Plus instrument ...
-
bioRxiv - Bioengineering 2024Quote: ... with 2 x 300 bp P2 kits (Illumina). In total ...
-
bioRxiv - Genomics 2022Quote: ... spun at 300G for 12 min at 4 ºC and resuspended in 20 uL transposition mix: 1X TD buffer and 2 uL of TDE1 (Illumina #FC-121-1030), 0.01% Digitonin in DMSO ...
-
bioRxiv - Genomics 2022Quote: ... and DRB3, 4, 5 (exon 2) genes with Fluidigm Access Array (Fluidigm, Singapore) and sequenced on an Illumina MiSeq sequencer (Illumina, San Diego, USA). HLA alleles and genotypes are called using the Omixon HLA Explore (version 2.0.0 ...
-
bioRxiv - Molecular Biology 2020Quote: ... using 2 x 100bp paired-end reads and 2 x 8bp or 2 x 12bp index reads with a 300-cycle kit (Illumina 20012860).
-
bioRxiv - Genomics 2020Quote: ... prior to cluster generation and paired-end short-read high throughput sequencing (2×150bp or 2×250bp) on an Illumina MiSeq or NextSeq550 equipment (Illumina, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... samples were sequenced on either the Illumina HiSeq 4000 or NextSeq sequencer with 2 × 151 bp or 2 × 76 bp reads (Illumina, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were diluted to 1.8nM and 2×300bp paired-end reads were generated on Illumina MiSeq 2 × 300 bp runs (Illumina, San Diego) by Source Bioscience.
-
bioRxiv - Microbiology 2024Quote: ... using 2 x 100-bp paired-end reads and 2 x 12-bp index reads with a 300-cycle kit (Illumina, 20012860).
-
bioRxiv - Neuroscience 2021Quote: ... The blunt-ended double-stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Cell Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Genomics 2021Quote: For each sample sequenced in 3 separate experiments (CoronaHiT-ONT, CoronaHiT-Illumina, ARTIC-ONT), a phylogeny was generated from all of the consensus genomes (n=216 for the routine samples and n=132 for the rapid response samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end sequencing was performed using TruSeq 3000 4000 SBS Kit v.3 (Illumina) on the HiSeq 4000 platform (11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... which was prepared with the QuantSeq 3’ mRNA-Seq Library Prep Kit from Illumina following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... and day 3 RNA using the TruSeq Stranded mRNA Library Prep Kit (Illumina 20020594) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The library was pooled with other samples at equimolar concentrations and sequenced at 4 nM as single lanes on Illumina NovaSeq 6000 S4 platform (2×150; Illumina Inc., San Diego, CA). The library for long-read data was prepared using the Nanopore ligation kit ...
-
bioRxiv - Genomics 2021Quote: ... Library preparation followed the TruSeq mRNA 2 (Illumina, USA) protocol and libraries were sequenced on an Illumina HiSeq 2500 platform (two lanes of 125 bp paired-end sequencing) ...
-
bioRxiv - Genomics 2021Quote: ... and sequenced with NovaSeq 6000 (2×150 bp) (Illumina). DNA was isolated from paired tumor-normal samples also using the AllPrep DNA/RNA/Protein Mini kit ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and TruSeq RNA Sample Preparation Kit version 2 (Illumina) according to the manufacturers’ protocols ...
-
bioRxiv - Molecular Biology 2020Quote: ... and sequencing (HiSeq, 2 × 150bp paired end, Illumina®) were performed by GENEWIZ (South Plainfield ...
-
bioRxiv - Genomics 2022Quote: ... following manufacturer’s recommendations and sequenced by Illumina HiSeq 2×150 cycles run (Illumina Inc., CA, USA).
-
bioRxiv - Genomics 2022Quote: ... refringens positive and negative samples were generated for RNAseq library construction and sequencing using the same protocol as described above and sequenced by Illumina HiSeq 2×150 cycles run (Illumina Inc., CA, USA).
-
bioRxiv - Evolutionary Biology 2020Quote: ... franciscae strain CBS2926T (Illumina, PE 2 x 100 bp) were sequenced and assembled at INRAE Montpellier ...
-
bioRxiv - Developmental Biology 2020Quote: ... 12 million 2×150 bp reads (Illumina Nextseq 500) were sequenced for each library.
-
bioRxiv - Genomics 2020Quote: ... PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina; see Supplementary Table 2) were not processed through hybridization and sequencing ...
-
bioRxiv - Immunology 2022Quote: ... and RNA sequencing (Illumina HiSeq, 2 x 150 bp).
-
bioRxiv - Microbiology 2022Quote: ... by 2×150 Paired End (PE) configuration by Illumina HiSeq ...
-
bioRxiv - Microbiology 2023Quote: ... for each sample 2 μl of 5’ adapter (Illumina) (total 12 μl ...
-
bioRxiv - Developmental Biology 2023Quote: ... read 2 - 91 cycles) performed with Nextseq 500 (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... After cluster generation on cBot 2 (Illumina, SanDiego, USA) using the HiSeq 3000/4000 SR Cluster Kit (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... Libraries (2×145 bp Illumina-compatible paired-end reads) were sequenced on a MiSeq® instrument (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA libraries with 2 % spiked-in PhiX control (Illumina) were sequenced at the 100-bp paired end on a P3 flow cell using an Illumina NextSeq2000 instrument at a sequencing depth of ∼80 K reads per cell ...
-
bioRxiv - Microbiology 2024Quote: ... Read 2 and Index Read—were obtained from Illumina MiSeq ...
-
bioRxiv - Cell Biology 2024Quote: ... The library was spiked with 2% PhiX library (Illumina) and sequenced on an iSeq 100 system.
-
bioRxiv - Microbiology 2020Quote: ... Samples were sequenced using the MiSeq 2×250 bp and HiSeq 2×150 bp paired-end read technology (Illumina, San Diego, CA, USA) as previously described [78] ...
-
bioRxiv - Genomics 2024Quote: ... and sequenced across three lanes of a HiSeq or pooled for sequencing on a NovaSeq S1 using 2×75 (HiSeq) or 2×101 (NovaSeq) read lengths (Illumina, San Diego, CA). Variant calling and neoantigen prediction were performed as described previously (22,23).
-
bioRxiv - Evolutionary Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina single indexed adapters (Illumina) were ligated ...
-
bioRxiv - Microbiology 2020Quote: ... 3’ adapter sequences from the Illumina TruSeq Small RNA Library Preparation Kit (Illumina, RS-200) were ligated onto the dsRNA species by mixing together 1 μl of adapter with 1 μg dsRNA in a 6 μl reaction and heated at 70°C for 2 minutes ...
-
bioRxiv - Genomics 2022Quote: ... An “A” base was then added to the 3’ end and the adaptor from Illumina was ligated only to one end of the resultant dsDNA as the other end contained a 5’ overhang introduced by the N9 primer ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by A-tailing and ligation at the 3’ ends with paired-end adaptors (Illumina) with a single “T” base overhang ...
-
bioRxiv - Cancer Biology 2021Quote: Four 3’ PCR primers were used each containing a unique index (underlined) recognized by Illumina:
-
bioRxiv - Synthetic Biology 2022Quote: ... adding barcodes to identify the sample (primers P3-P15 in Supplementary Table 3, containing Illumina Nextera tagmentation adapters and ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Biochemistry 2023Quote: ... mRNA libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina). Quality of mRNA libraries was determined using Agilent Tape Station and mRNA was sequenced at 75 bp single read sequencing using NextSeq 500 (Illumina).