Labshake search
Citations for Illumina :
1851 - 1900 of 2399 citations for 6 Methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... libraries were amplified for 5 cycles with 0.5 μl i5 and i7 Nextera adapters (10 μM) following the instructions provided by Illumina. Finally ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries for 5 biological replicates were pooled and 100bp paired end reads were generated on a NovaSeq 6000 (Illumina). Reads were trimmed and quality filtered using TrimGalore with a minimum phred score of 20 then aligned to hg19 using STAR 64 with quantMode to obtain read counts ...
-
bioRxiv - Genetics 2024Quote: ... 5 µg of total RNA for each sample was then processed using the Tru-Seq stranded mRNA kit (Illumina) following manufacturer instructions ...
-
bioRxiv - Microbiology 2020Quote: ... first using the differential coverage information from only the same plant as the assembly (i.e. the corresponding 3 Illumina metagenomes 2016, 2017 and 2018), or differential coverage information from all of the Illumina metagenomes (69 in total) ...
-
bioRxiv - Neuroscience 2022Quote: ... Sequencing libraries were prepared by transposase-assisted tagmentation and enrichment of 3’end of genes using Nextera XT DNA Library Prep Kit (Illumina, San Diego, CA, USA). The libraries were sequenced on the HiSeq2500 for 25 and 75 cycles paired-end reads ...
-
bioRxiv - Immunology 2024Quote: ... China), using Chromium Single Cell 3’ Reagent Kits v2 (from 10x Genomics, Pleasanton, CA, USA) and NovaSeq 6000 System (Illumina, San Diego, CA, USA) respectively ...
-
bioRxiv - Genomics 2023Quote: ... RNA was extracted from similar pooled-samples (N = 3) using the ZYMO (Irvine, CA, USA) direct-zol miniprep kit (Cat. # R2050) and sequenced using NovaSeq (Illumina, San Diego, CA, USA) paired-end (150 bp ...
-
bioRxiv - Genetics 2021Quote: ... Individual libraries were pooled in equimolar ratio (4 nM for each) and sequenced with the Nextseq 550 platform (Illumina, San Diego, California) in a single end 75 cycles high output run ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Libraries were diluted from 26.2 nM (HBA1) and 33.4 nM (HBA2) to a concentration of 4 nM and pooled for sequencing on a MiSeq (Illumina, San Diego, CA).
-
bioRxiv - Cancer Biology 2023Quote: ... 4) tagmentation was performed with 2ng input and sequencing library generated using the Nextera XT library prep kit (Illumina, #FC-131-1024). In short ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were diluted to a final concentration of 4 nM and sequenced with the NextSeq 500/550 HighOutput Kit v2.5 (75 cycles, Illumina, cat. no. 20024906), with 75 bp reads and pair-end sequencing ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% of PhiX (Illumina) was used as run control ...
-
bioRxiv - Immunology 2021Quote: ... Libraries were prepared following 10X Genomics protocols (Chromium Single Cell 3’ Reagent Kits v2 Chemistry) and sequenced on NovaSeq 6000 (Illumina S2 flow cell, paired-end). FASTQ files were processed using cellranger (https://support.10xgenomics.com/single-cell-gene-expression/software/pipelines/latest/what-is-cell-ranger ...
-
bioRxiv - Microbiology 2022Quote: ... and R2-Uni13 (5’-GTC TCG TGG GCT CGG AGA TGT GTA TAA GAG ACA GAG TAG AAA CAA GG-3’) (adaptor and barcode oligonucleotide sequences from Illumina, Inc., San Diego, CA, USA). Annealing and extension steps were performed for 30 s at 55oC and 7 m at 72oC ...
-
bioRxiv - Cell Biology 2020Quote: ... Purified cells were lysed in ATAC lysis buffer for 5 min to get nuclei and then transposed with Tn5 transposase (Illumina) for 30 min ...
-
bioRxiv - Microbiology 2021Quote: PCR free shotgun libraries were prepared for each sample from 2.5 ug metagenomic DNAs by Exeter Sequencing Service for the metagenomic sequencing using the TruSeq DNA library Prep Kit (Illumina). The libraries were sequenced to approximately 7GBp using the HiSeq 2500 rapid run mode (2X 250 bp paired end ...
-
Diversified expression of gamma-protocadherins regulates synaptic specificity in the mouse neocortexbioRxiv - Neuroscience 2021Quote: We acquired 212.66 GB clean reads for the 5’ gene expression library and 183.30 GB for the 5’ pcdhg expression library from the sequencing platform NovaSeq 6000 (Illumina, Novogene). 5’ gene expression sequencing data were aligned by Cellranger v3.0.2 (10X Genomics) ...
-
bioRxiv - Genomics 2021Quote: ... cDNA and barcode libraries were checked for quality on an Agilent 4200 TapeStation, quantified by KAPA qPCR, and sequenced on a single lane (95% transcriptome, 5% barcode) on Novaseq6000 (Illumina) to an average depth of 100,000 reads per cell.
-
bioRxiv - Genomics 2021Quote: ... Libraries were pooled and sequenced single-end for 75 cycles on one high-output flow cell of an Illumina NextSeq with 5% PhiX control (Illumina) added to provide sequence diversity ...
-
bioRxiv - Microbiology 2021Quote: ... a PhiX spike-in of 2.5-5% was added to the pools (PhiX Sequencing Control v3; Illumina # FC-110-3001). Samples were run on the Illumina NextSeq 500 ...
-
bioRxiv - Microbiology 2021Quote: ... 50 ng of each amplicon was dual indexed in a 5-cycle PCR reaction using the PCR module and indexed primers from the Nextera kit (Illumina). Resulting libraries were purified on AMPure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 5’ CGT ACA GCG GCT TGT TGG CTG TGA, and fA23M, 5’ GCG CTC CAG CTC CTT CTG CCC ATA, primers to which the Illumina sequencing primer sequences were attached to their 5’ ends) ...
-
bioRxiv - Microbiology 2022Quote: ... a PhiX spike-in of 2.5–5% was added to the pools (PhiX sequencing control v3; Illumina FC-110-3001). Samples were run on the Illumina NovaSeq 6000 platform (single-read 1 ×85 cycles and 6 × i7 index cycles).
-
bioRxiv - Cancer Biology 2020Quote: Genomic DNA from 28 samples in which scDNA-seq data showed at least 5% of homozygously mutated clones were analyzed by Illumina Omni2.5-8 SNP array ...
-
bioRxiv - Molecular Biology 2020Quote: ... nuclei were isolated from 100,000 cells and sequencing adapters were transposed for 30 minutes at 37°C using 5 μl of TDE1 (Nextera Tn5 transposase, Illumina). After PCR and gel purification ...
-
bioRxiv - Genomics 2021Quote: ... The samples were amplified for 5-8 cycles as determined by qPCR for Illumina sequencing using Nextera library preparation kit (Illumina) and samples were paired-end sequenced on HiSeq4000 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... TASSEL 5 GBS v2 pipeline (52) was used to perform the SNP calling of the sequence data obtained from Illumina sequencing ...
-
bioRxiv - Physiology 2021Quote: ... Single-indexed strand-specific cDNA library from total RNA samples (500 ng input with RIN ≥ 5) was prepared using TruSeq Stranded mRNA Library Prep Kit (Illumina) as per directions by the manufacturer ...
-
bioRxiv - Microbiology 2021Quote: ... 1.5 μg of purified RNA for each sample was processed using the Ribozero rRNA Removal Kit (Gram-negative bacteria) (Illumina) according to the manufacturer’s instructions except that reaction volumes were reduced by 50% ...
-
bioRxiv - Genetics 2021Quote: ... and ribosomal RNA was depleted from 5 ug of total RNA using the Ribo-Zero™ Gold Kit (Illumina, Inc.). Depleted mRNA was fragmented and converted to first strand cDNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting 10 nM pool was denatured to 10 pmol with 5% PhiX spike-in and sequenced as single-read on HiSeq 2500 (Illumina) in rapid mode for 51 cycles (plus 7 cycles index read ...
-
bioRxiv - Microbiology 2021Quote: ... Total 5 μg of RNA was used for rRNA depletion by using Ribo-Zero™ (Epicentre, Illumina, Madison, WI USA) kit and purified by using Qiagen-RNeasy miniElute (Qiagen GmbH ...
-
bioRxiv - Immunology 2020Quote: ... 0.3 to 0.5 ng of pre-amplified cDNA was used to generate barcoded Illumina sequencing libraries (Nextera XT library preparation kit, Illumina) in an 8μL reaction volume ...
-
bioRxiv - Genomics 2021Quote: ... The 20 ul preamp was then mixed with 25 ul TD buffer and 5 ul TDE1 buffer (Nextera kit, FC-131-1096, Illumina) and incubated for 5 min at 55 C and held at 10 C ...
-
bioRxiv - Microbiology 2022Quote: ... Ribosomal RNA (rRNA) was subsequently depleted from each RNA sample (5 µg each) using the bacterial Ribo-Zero rRNA Removal Kit (Illumina). The integrity of the RNA was evaluated using an RNA 6000 Nano LabChip and an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’) and Reverse Library primers (5’CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTT CCGATC3’, where NNNNNN denotes the barcodes, e.g. Index1 is CGTGAT for Illumina sequencing). Three rounds of agarose gel purification were performed to purify the fragments of 200~650 bp using QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing was performed at 5 million reads/sample in single-end mode with 150 nt read length on the NextSeq 500 platform (Illumina) using a Mid output sequencing kit ...
-
bioRxiv - Neuroscience 2022Quote: ... Each pool was sequenced on the Illumina NextSeq 500 after the addition of 5% PhiX sequencing control library (FC-110-3002; Illumina) using the following settings ...
-
bioRxiv - Microbiology 2024Quote: ... All samples were pooled to a final concentration of 5-10 ng/µL and sequenced on a NextSeq 500 (Illumina). The demultiplexed data was assembled and SNPs detected with Pilon software using reference genome sequences.84
-
bioRxiv - Microbiology 2023Quote: ... a PhiX spike-in of 2.5–5% was added to the pools (PhiX sequencing control v3; Illumina FC-110- 3001). Samples were run on the Illumina NovaSeq 6000 platform (single-read 1 ×85 cycles and 6 × i7 index cycles).
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified with AMPure XP purification kit and Sixteen-plexed samples were pooled in approximately equimolar amounts of 5 nM and run in a single and double index reads on a Hiseq 4000 (Illumina).
-
bioRxiv - Genomics 2022Quote: Small RNA libraries were prepared starting from 5 µL RNA eluate using the TruSeq Small RNA Library Prep Kit (Illumina, RS-200-0012 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were pooled at a concentration of 5 nM and run on an Illumina HI-SEQ 2500 sequencer (Illumina) to obtain paired-end reads of 75 bases (PE75) ...
-
bioRxiv - Genomics 2023Quote: ... We used 15 mins incubation on ice in the nuclei preparation step and the Tn5 reaction was performed in 50 μl of custom transposition buffer (10 mM Tris pH 8, 5 mM MgCl2 and 10% dimethylformamide) with 2.5 μl Tn5 transposase (Illumina, 20034197) at 37°C while mixing at 1000 rpm for 30 mins ...
-
bioRxiv - Genetics 2023Quote: ... Plasma was divided from maternal peripheral blood (5[mL) by centrifuging and then 600[μL (Ion Torrent) or 1.4 mL (Illumina CN500) plasma was used to extract cell-free DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 sec at 62°C and a final extension step of 5 min at 62°C) and sequenced using the NOVASeq platform (Illumina).
-
bioRxiv - Genomics 2023Quote: ... groups was based on 5 μg of total RNA according to the manufacturer’s protocol using the Illumina HiScanSQ Instrument (Illumina, USA) and sequenced in the same flow cell as paired-end (2 × 100 bp) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: The reverse transcription products (5 μL) were mixed with Eco™ Real-Time PCR System (Illumina, San Diego, CA, USA) and primers ...
-
bioRxiv - Systems Biology 2024Quote: ... The quality of each sequencing run was controlled by adding up to 5% of denatured and diluted down to 20pM PhiX (Illumina). Demultiplexing of the data by sample using the defined index pairs was performed automatically by Illumina BaseSpace.
-
bioRxiv - Developmental Biology 2024Quote: ... Gene expression and CRISPR libraries were prepared according to the CG000510 Chromium NextGEM Single Cell 5’ v2 CRISPR User Guide (Rev B, 10x Genomics) and sequenced on NextSeq and NovaSeq platforms (Illumina).