Labshake search
Citations for Illumina :
1751 - 1800 of 9681 citations for ssc mir 299 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... and a TruSeq RNA Library Preparation Kit (Illumina, USA) was used to build the libraries according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... using the Illumina DNA Prep with Enrichment Kit (Illumina). In brief ...
-
bioRxiv - Cancer Biology 2024Quote: ... The TruSeq Stranded mRNA Sample Preparation Kit (Illumina Inc.) was used for next generation sequencing library construction per manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2024Quote: ... preparation of the libraries (Illumina mRNA library preparation Kit) and sequencing (Illumina HiSeq1500 ...
-
bioRxiv - Molecular Biology 2024Quote: ... from Illumina Tagment DNA Enzyme and Buffer Small Kit (Illumina, 20034197), 16.5 μl PBS ...
-
bioRxiv - Microbiology 2024Quote: ... the Nextera DNA Flex Library Prep Kit (Illumina, 20018704) was used to prepare the Illumina libraries ...
-
bioRxiv - Microbiology 2024Quote: ... and the 300-cycle iSeq Reagent Kit v2 (Illumina) according to manufacturer instructions ...
-
High-resolution chromosome-level genome provides molecular insights into adaptive evolution in crabsbioRxiv - Genomics 2024Quote: ... the TruSeq PE Cluster Kit v4-cBot -HS (Illumina) was employed to cluster the index-coded samples on the cBot Cluster Generation System ...
-
bioRxiv - Cell Biology 2024Quote: ... libraries were generated using the NexteraXT kit from Illumina. Libraries were multiplexed ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were prepared using the Truseq kit from Illumina using the manufacturer’s protocol (https://www.illumina.com/products/by-type/sequencing-kits/library-prep-kits/truseq-stranded-mrna.html) ...
-
bioRxiv - Genetics 2024Quote: ... Ligation Kit (#20040534, Illumina, San Diego, CA, United States). Library insert size was determined using an Agilent Bioanalyzer ...
-
bioRxiv - Genomics 2024Quote: ... with the MiSeq Reagent kit v3 (600-cycles; Illumina). From obtained sequences ...
-
bioRxiv - Cell Biology 2024Quote: ... mRNA libraries were constructed using Truseq kits from Illumina and were sequenced on Illiumina Nextseq P3 (paired-end ...
-
bioRxiv - Molecular Biology 2024Quote: ... mRNA library preparation using TruSeq Stranded mRNA kit (Illumina) and Illumina sequencing (30 million reads ...
-
bioRxiv - Neuroscience 2024Quote: ... we used TruSeq RNA Sample Prep kit v2 (Illumina). We performed poly-A enrichment on 1 μg of total RNA per sample ...
-
bioRxiv - Cancer Biology 2024Quote: ... were sequenced with the MiSeq Reagent Kit v3 (Illumina) 64 bp single-end reads with an aimed coverage of 50 to 100 reads/barcode.
-
bioRxiv - Systems Biology 2024Quote: ... The Nextera XT DNA Library Preparation Kit (Illumina 15032354) was used to perform tagmentation of 1 ng of cDNA ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR-generated amplicon libraries were subjected to 250 nt paired-end sequencing on a MiSeq platform (Illumina, San Diego, CA, USA).
-
bioRxiv - Cancer Biology 2022Quote: ... an equal combination of additional PCR products containing two inverse barcodes (GACTCAGTGTCAGACTGAGTGTCTGACTGT and CTGAGTCACAGTCTGACTCACAGACTGACA) plus the PhiX Control V3 (Cat. FC-110-3001, Illumina, CA, USA) were spiked in to balance the nucleotide distribution within the library ...
-
bioRxiv - Genomics 2022Quote: ... USA) for short read sequencing as specified in the TruSeq DNA PCR-Free Reference Guide (Oct 2017, Illumina, San Diego, CA, USA). A library was prepared using a TruSeq DNA PCR-Free library preparation kit according to manufacturer guidance and was sequenced on a NextSeq500 instrument (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... Sequence libraries of the V1 and V3 region of the 16S rRNA genes from each of the samples were constructed in accordance with the Dual Barcoded Two-Step PCR procedure from Illumina (Illumina, 2013). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: ... and PCR and sequencing were performed as described previously (2 x 250bp paired-end reads, on an Illumina Miseq (Lemont, IL, USA)) [68–70] ...
-
bioRxiv - Microbiology 2022Quote: ... in a 100 µl reaction with 2 µl gDNA (∼100 ng) and primers oJMP697 and oJMP698 (nested primers with adapters for index PCR with Illumina TruSeq adapter) according to the manufacturer’s protocol using a BioRad C1000 thermalcycler with the following program ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... although sequence data for each isolate is derived from pools of individuals (except from PCR-free Illumina sequence data for S. avenae), all individuals sequenced for a given isolate are expected to contain the same two haplotypes and so sequence data can be combined to reconstruct fully phased haplotypes for each isolate.
-
bioRxiv - Synthetic Biology 2024Quote: ... Extracted DNA was PCR amplified with a forward primer binding to the end of the leader sequence (PCR1 Fwd primer with Illumina adapter overhang) and a reverse primer annealing to the intronic region directly 3’ of the J segment (PCR1 Rev primer with Illumina adapter overhang) ...
-
bioRxiv - Physiology 2024Quote: ... tagmented DNA was amplified by PCR in a reaction mix (5 µL DNA, 2.5 µL of 25 μM forward primer (Nextera/Illumina i5 adaptors (Illumina)) ...
-
bioRxiv - Systems Biology 2023Quote: ... in a 100 µl reaction with 2 µl gDNA (∼100 ng) and primers oJMP697 and oJMP698 (nested primers with adapters for index PCR with Illumina TruSeq adapter) according to the manufacturer’s protocol using a BioRad C1000 thermocycler with the following program ...
-
bioRxiv - Genetics 2023Quote: ... in a 100 µl reaction with 2 µl gDNA (∼100 ng) and primers oJMP697 and oJMP698 (nested primers with partial adapters for index PCR with Illumina TruSeq adapter) according to the manufacturer’s protocol using a BioRad C1000 thermal cycler with the following program ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and g2997a) at the forward primer binding site used in the ‘round 1 PCR’ step below (the step attaching partial Illumina sequencing adaptors), thus excluding PCR amplification of the competitor viruses during sequencing library preparation such that only the library viruses ...
-
bioRxiv - Cancer Biology 2023Quote: ... Bacterial 16S rRNA gene V1-V2 region was amplified using 27F and 338R PCR primers and sequenced on a MiSeq (2×250 bp; Illumina, Hayward, CA). Bioinformatic processing and statistical analysis were performed in R software environment as described previously 62 ...
-
bioRxiv - Genetics 2023Quote: ... 10 ng of amplicon DNA from PCR reaction 1 was combined with 10 µL of Nextera adapter index primers (Illumina Cat#20027213) and 25 µL Kapa HiFi Hotstart ReadyMix ...
-
bioRxiv - Genetics 2024Quote: ... 10 ng of amplicon DNA from the first PCR reaction was combined with 10 µL of Nextera adapter index primers (Illumina Cat#20027213) and 25 µL Kapa HiFi Hotstart ReadyMix ...
-
bioRxiv - Microbiology 2020Quote: ... Library construction and sequencing were conducted using the Illumina Nextera NGS Library Prep Kit or the Illumina Nextera XT DNA Library Prep Kit (Illumina, San Diego, CA). Libraries were sequenced on an Illumina NextSeq with 150bp paired-end reads ...
-
bioRxiv - Genomics 2020Quote: ... The resulting nuclei were resuspended in 50µl of transposition reaction buffer (25µl of 2x TD buffer from the Nextera kit, Illumina; 2.5µl of Tn5 transposase enzyme from the Nextera kit, Illumina; 22.5µl of nuclease free water), and incubated at 37°C for 90 min for chromatin tagmentation ...
-
bioRxiv - Microbiology 2019Quote: ... One to two ng of DNA per sample were taken for library preparation using the Nextera XT DNA Library Preparation Kit and uniquely indexed samples using the Nextera XT Index Kit were pooled and sequenced together (both Illumina, San Diego, California). Pooled libraries were sequenced with paired-end reads (2×150-250 ...
-
bioRxiv - Plant Biology 2020Quote: ... followed by paired end sequencing (100bp x 2) on a HiSeq2000 with a HiSeq Paired-End Cluster Generation Kit and HiSeq Sequencing Kit (Illumina, San Diego, U.S.A.). Trimmomatic (ver ...
-
bioRxiv - Cell Biology 2021Quote: ... Cluster generation and sequencing involved application of the TruSeq SR Cluster Kit v4-cBot-HS or TruSeq PE Cluster Kit v4-cBot-HS (Illumina, Inc, California, USA) using 8 pM of pooled normalized libraries on the cBOT ...
-
bioRxiv - Immunology 2022Quote: ... purified with NucleoSpin Gel and PCR Clean-up kit (Quiagen, cat. 740609.50) and sequenced on the MiSeq platform with a MiSeq 600 cycle v3 kit (Illumina, cat. MS-102-3003).
-
bioRxiv - Microbiology 2022Quote: ... Libraries of 3 nM and above concentration were loaded on to NovaSeq 6000 S4 Reagent Kit using a paired-end 150 kit (20012866; Illumina, San Diego, CA). Each sample was sequenced to a depth of at least 19.5 million reads ...
-
bioRxiv - Cell Biology 2022Quote: ... 1,500ng of RNA at 50ng/μl was processed using Ribo-Zero Gold purification (QIAseq FastSelect -rRNA HMR Kit #334387) and NEBNext® Ultra™ II RNA Library Prep Kit (Illumina #E7770L). cDNA was sequenced using paired-end 150bp chemistry on a HiSeq 4000 instrument (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... Libraries were prepared using the New England Biolabs NEBNext rRNA depletion kit (Bacteria) and NEBNext Ultra II Directional RNA library prep kit (Illumina, San Diego, CA). The libraries were quantified by KAPA qPCR library quantitation assays and sequenced paired-end using MiSeq platform (Illumina ...
-
bioRxiv - Genetics 2019Quote: Libraries for the pENTR and pDEST (pTrypLib) ORF plasmid libraries were prepared for next generation Illumina sequencing using tagmentation kits from Illumina (Nextera XT kit) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... Tagmentation and library preparation was done using the Nextera XT DNA Library Prep kit and sequenced using the NextSeq 500/550 High Output Kit v2 (75 cycles) 400 million reads (Illumina, #FC-404-2005) on Illumina NextSeq 500 platform ...
-
bioRxiv - Immunology 2019Quote: ... RNA-seq libraries were prepared using the TruSeq Stranded Total RNA kit paired with the Ribo-Zero rRNA removal kit (Illumina, San Diego, CA). Libraries were sequenced on an Illumina HiSeq 4000 instrument ...
-
bioRxiv - Microbiology 2019Quote: Sample dilution and library construction were performed with halved reactions according to the manufacturer’s instructions for the three library preparation kits evaluated: Nextera XT DNA Library Prep Kit (Illumina, San Diego, CA USA) and KAPA HyperPlus Kit (Roche ...
-
bioRxiv - Neuroscience 2019Quote: ... Tissue RNA-seq was generated using the TruSeq RNA Sample Preparation Kit v2 and Ribo-Zero rRNA removal kit (Illumina, San Diego, CA). For RNA-seq data processing ...
-
bioRxiv - Immunology 2021Quote: ... Sequencing was performed in the Human Immunology Core Facility at the University of Pennsylvania using an Illumina 2× 300-bp paired-end kit (Illumina MiSeq Reagent Kit v3, 600-cycle, Illumina MS-102-3003).
-
bioRxiv - Immunology 2021Quote: ... Libraries were quantified sing Qubit High-Sensitivity DNA kit and preparation kit and libraries were constructed using Nextera XT DNA tagmentation (Illumina FC-131-1096) using 800 pg of pooled cDNA library as input using index primers with format as in Gierahn et al [46] ...
-
bioRxiv - Molecular Biology 2022Quote: ... Purified multiplexed libraries were diluted to 2nM concentration (calculated based on the Qubit dsDNA HS Assay Kit) for sequencing using NextSeq 500/550 v2.5 Kit (Illumina, 35bp paired-end reads). Finally ...
-
bioRxiv - Molecular Biology 2022Quote: ... prior to mixing of multiplexed libraries diluted to 2nM concentration (calculated based the on Qubit dsDNA HS Assay Kit) for sequencing using the NextSeq 500/550 v2.5 kit (Illumina, 75bp single-end reads). Finally ...