Labshake search
Citations for Illumina :
1701 - 1750 of 10000+ citations for Two Hybrid System Construction kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... multiplexed and sequenced (100 bp pair-end) using a NextSeq 550 System (Illumina, San Diego, CA). DESeq2 computational pipeline116 was used to estimate the raw count reads aligned to the reference genome ...
-
bioRxiv - Neuroscience 2019Quote: ... Libraries were pooled and then pair-end sequenced for 75bp by NextSeq 500 System by Illumina® (NextSeq® High Output Kit v2 ...
-
bioRxiv - Microbiology 2020Quote: ... Library preparation was carried out according to the MiniSeq System Denature and Dilute Libraries Guide (Illumina). Sequencing was performed on all four biological replicates (Fig ...
-
bioRxiv - Microbiology 2021Quote: ... and the DNA library was sequenced on the Illumina MiSeq next generation sequencing system (Illumina Inc.) in paired end mode with 2 x 250 bp ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were used for paired-end sequencing (2 x 35 cycles) on a NextSeq500 system (Illumina).
-
bioRxiv - Cell Biology 2020Quote: ... Quantified libraries were sequenced paired-end with 300 cycles on a NextSeq 550 sequencing system (Illumina) with a spike-in of 20% phiX gDNA library (Illumina) ...
-
bioRxiv - Microbiology 2021Quote: ... paired-end whole-genome Next-Generation Sequencing (NGS) was performed on a MiSeq system (Illumina, USA) with read lengths of 150 bps ...
-
bioRxiv - Cancer Biology 2020Quote: ... Founders were genotyped for SRR2 deletion by PCR and mosaicism estimated using the MiSeq system (Illumina) (Table S3 ...
-
bioRxiv - Immunology 2022Quote: ... Libraries were then pooled and sequenced on an Illumina Miseq System (Illumina, San Diego, California, USA).
-
bioRxiv - Cancer Biology 2022Quote: ... Cluster amplification and generation of sequencing data were performed on the NovaSeq 6000 system (Illumina Inc.) using 2×100 paired-end cycles ...
-
bioRxiv - Cancer Biology 2022Quote: ... The generated libraries were sequenced by a NovaSeq 6000 sequencing system (Illumina, San Diego, CA, USA) to an average of 50,000 mean reads per cell ...
-
bioRxiv - Microbiology 2020Quote: ... per lane and were sequenced using an Illumina HiSeq 2500 Rapid Run (150 bp) system (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... DNA fragmentation and Illumina P7 adaptor (CAAGCAGAAGACGGCATACGAGAT) ligation were performed in NeoPrep Library Prep System (Illumina). Transposon junctions were amplified by using a transposon specific primer Mariner_1R_TnSeq_noMm (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCGGGGACTTATCAGCCAACC ...
-
bioRxiv - Immunology 2021Quote: ... Sequencing was performed in paired-end mode (2×75 cycles) on a NextSeq 500 System (Illumina). This procedure was utilized for three different BMs ...
-
bioRxiv - Immunology 2020Quote: ... Plate pools were normalized to 2 nM and sequenced on the NovaSeq 6000 Sequencing System (Illumina) using 2×100bp paired-end reads with an S4 300 cycle kit (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 × 75 bp paired-end sequencing was carried out using a HiSeq 4000 system (Illumina). Sequencing reads were aligned to the corresponding genome sequence using HiSat2 (--no-spliced-alignment ...
-
bioRxiv - Microbiology 2021Quote: ... genomic DNA from parental and mutant cell lines were sequenced by the HiSeq4000 sequence system (Illumina), generating about 10 million 100-bp reads and compared to that of the T ...
-
bioRxiv - Microbiology 2021Quote: ... High-throughput sequencing was performed as paired-end 100 sequencing using the HiSeq X10 system (Illumina).
-
bioRxiv - Developmental Biology 2022Quote: ... Plate pools were normalized to 2 nM and sequenced on the NovaSeq 6000 Sequencing System (Illumina) using 2×100bp paired-end reads with an S4 300 cycle kit (Illumina ...
-
bioRxiv - Genetics 2022Quote: ... mRNA sequencing was carried out on the Illumina Hiseq 2500 system (Illumina, San Diego, CA, USA) and 150 bp paired-end FASTQ read files were generated ...
-
bioRxiv - Systems Biology 2019Quote: ... Libraries were pooled in equimolar and cluster generation was performed on the Illumina cBOT system (Illumina). Sequencing (150bp pair-end ...
-
bioRxiv - Neuroscience 2019Quote: ... and sequencing were performed at the Broad Technology Labs Boston using the NextSeq-500 system (Illumina). Differentially expressed genes for ULI RNAseq were determined as having at least 10 reads and a p-value < 0.05 ...
-
bioRxiv - Molecular Biology 2019Quote: ... a barcoded amplicon mixture was loaded on mini-SEQ analyzer (Illumina MiniSeq system, SY-420-1001) and targeted deep sequencing was performed according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... Equal concentrations of different barcoded libraries were pooled and sequenced on a NovaSeq 6000 system (Illumina). Raw data were processed with the ENCODE 4 pipeline for Histone ChIP-seq according to ENCODE 4 standards (https://www.encodeproject.org/chip-seq/histone/) ...
-
bioRxiv - Microbiology 2020Quote: ... and gene sequencing was performed using an Illumina MiSeq Sequencing system (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... RT-qPCR was performed in triplicate with the Eco Real-Time PCR System (Illumina, CA, USA), using primer sets for (Supplementary Table 1) ...
-
bioRxiv - Genomics 2021Quote: ... Sequencing of cDNA libraries was achieved using the NovaSeq 6000 sequencing system (Illumina, Vancouver, BC, Canada). Total sequencing read counts can be found in Table S1.
-
bioRxiv - Cancer Biology 2020Quote: ... Libraries were pooled in equimolar and cluster generation was performed on the Illumina cBOT system (Illumina). Sequencing (150bp pair-end ...
-
bioRxiv - Microbiology 2020Quote: ... and sequenced from paired ends on the NextSeq 550 (2 x 150 bp) system (Illumina, USA).
-
bioRxiv - Immunology 2020Quote: ... 2×75bp paired-end read sequencing runs were performed on a NextSeq 500 system (Illumina, Inc.) using High-Output 150 flow cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... and libraries were then denatured and diluted according to the NextSeq® 500 System Guide (Illumina). RNAseq was then performed on a NextSeq 500 (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... the libraries were sequenced 150 bp paired-end on the NovaSeq6000 system (Illumina, San Diego, USA). The samples had an estimated coverage of 100x for the evolved clones and 200x for the three SA ancestors.
-
bioRxiv - Developmental Biology 2022Quote: ... Multiplexed libraries (10ρM) were loaded onto flow cells and sequenced on the HiSeq 1500 system (Illumina) in high-output mode using the HiSeq Cluster Kit v4 (Illumina) ...
-
bioRxiv - Cell Biology 2022Quote: ... Paired- end single cell 3’ gene expression libraries were sequenced on a Novaseq 6000 System (Illumina) using a NovaSeq S1 flow-cell to a depth of at least 3.5 × 108 reads/timepoint.
-
bioRxiv - Immunology 2022Quote: ... Libraries were diluted to 4nM and pooled before sequencing on the NextSeq 500 Sequencing system (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... The product was used to construct a barcoded cDNA library using the Nextera XT system (Illumina) which was sequenced on NovaSeq 6000 at the Australian Genome Research Facility (AGRF) ...
-
bioRxiv - Genetics 2022Quote: ... Indexed multiplexed sequencing was performed on the Novaseq 6000 system (S4 flow cell, Xp workflow; Illumina), collecting approximately 30 million paired-end reads per sample with 100 base read length ...
-
bioRxiv - Plant Biology 2023Quote: ... Sequencing of the amplicons were performed in an Illumina MiSeq system (Illumina, San Diego, CA, USA) with 500 cycles.
-
bioRxiv - Molecular Biology 2022Quote: Single-end sequencing was performed in the Illumina HiSeq 1500 system (Illumina, San Diego, CA, USA) with a coverage of 74 bp ...
-
bioRxiv - Physiology 2022Quote: ... The libraries were sequenced using paired-end 150 bp sequencing on a HiSeq 4000 System (Illumina). Muscle ...
-
bioRxiv - Immunology 2023Quote: ... we performed high-throughput DNA sequencing of the tagmented library on a NextSeq 500 System (Illumina) to generate paired-end ...
-
bioRxiv - Immunology 2022Quote: The bead purified library pool was sequenced on the NextSeq2000 system (Illumina Inc. San Diego, USA) with a read setup of PE 2×100 bp ...
-
bioRxiv - Cell Biology 2023Quote: ... The cDNAs were amplified by PCR and the libraries were sequenced using the HiSeq systems (Illumina) platform at the UMass Medical School Deep Sequencing Core Facility.
-
bioRxiv - Molecular Biology 2023Quote: The tagged libraries were pooled and sequenced and sequenced on a HiSeq PE150 system (Illumina, USA), producing metagenomics datasets of 26.5±0.5 millions of 150 bp paired-end reads per sample ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA from parental and mutant cell lines were sequenced by the HiSeq4000 sequence system (Illumina), generating about 10 million 100-bp reads and compared to that of the T ...
-
bioRxiv - Molecular Biology 2023Quote: Single-end sequencing (50 nt) of the libraries was performed on a NovaSeq 6000 system (Illumina).
-
bioRxiv - Evolutionary Biology 2023Quote: ... cDNA libraries were sequenced on the NovaSeq 6000 SP system (paired end; Illumina, San Diego, CA). Five biological replicates were processed for each experimental condition (control and Otp KD [siRNA1–3] groups ...
-
bioRxiv - Immunology 2023Quote: ... Barcoded cDNA transcripts from patients were pooled and sequenced using the NovaSeq 6000 Sequencing System (Illumina). For single-cell TCR sequencing ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were sequenced as paired-end 150×150bp on a NovaSeq® 6000 System (Illumina, Inc.).
-
bioRxiv - Systems Biology 2023Quote: ... and 36-bp single-end sequencing of the libraries was processed with a HiSeq3000 system (Illumina).