Labshake search
Citations for Illumina :
1651 - 1700 of 9201 citations for hsa mir 185 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... using the Novaseq SP 100 cycles sequencing kit (Illumina) with 1% PhiX and the following sequencing parameters ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the HiSeq Rapid SBS Kit v2-HS (Illumina) to produce paired-end reads of 127 nucleotides ...
-
bioRxiv - Genomics 2023Quote: ... Samples were sequenced using a NovaSeq SP kit (Illumina) with 50 bp paired-end reads at a sequencing depth of approximately 25 million reads per sample.
-
bioRxiv - Microbiology 2023Quote: ... with the MiSeq® Reagent Kit v3 (Illumina Inc.) to produce 2×300 bp reads.
-
bioRxiv - Microbiology 2023Quote: ... library preparation was performed using DNA Prep Kits (Illumina) and these libraries were sequenced on a NovaSeq 6000 instrument (Illumina ...
-
bioRxiv - Bioengineering 2023Quote: ... using a 150-cycle MiSeq Reagent Kit v3 (Illumina) following the manufacturer’s procedure ...
-
bioRxiv - Genetics 2023Quote: ... or the 75 cycle High Output Kit (Illumina # 20024906), 37 cycles per read.
-
bioRxiv - Immunology 2023Quote: ... using the NovaSeq6000 S4 Reagent Kit (200 cycles) (Illumina). An average of 9 million paired reads were generated per sample.
-
bioRxiv - Genomics 2023Quote: ... and sequenced using a high output reagent kit (Illumina) at the Institute for Molecular Bioscience Sequencing Facility ...
-
bioRxiv - Immunology 2023Quote: ... Nextera XT DNA sample preparation and index kits (Illumina) were used for preparation of libraries that were sequenced by the Functional Genomics Center Zurich (Zurich ...
-
bioRxiv - Neuroscience 2023Quote: ... the TruSeq Stranded Total RNA Library Prep Kit (Illumina) was employed ...
-
bioRxiv - Cancer Biology 2023Quote: ... libraries were generated using Truseq library preparation kits (Illumina) and samples run on the HiSeq4000 platform in a 76bp pair-end sequencing format ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The MiniSeq Mid Output Kit (300-cycles) (Illumina, USA) was used for paired-end sequencing (2x150 bp) ...
-
bioRxiv - Neuroscience 2023Quote: ... we used TruSeq RNA Sample Prep kit v2 (Illumina). We performed poly-A enrichment on 1 μg of total RNA per sample ...
-
bioRxiv - Cell Biology 2023Quote: ... using the High Output Kit v2.5 (Illumina, cat.no. 20024906) with 75 cycles of single-end sequencing ...
-
bioRxiv - Developmental Biology 2023Quote: ... using Nextseq 500/550 High Output v2.5 Kit (Illumina) to obtain single end 75 nt reads.
-
bioRxiv - Immunology 2023Quote: ... using a NovaSeq 6000 SP Reagent Kit v1.5 (Illumina).
-
bioRxiv - Molecular Biology 2023Quote: ... based on a Mid Output Kit 2.5 (Illumina, 20224904) using 75 cycles and single-end reads ...
-
bioRxiv - Molecular Biology 2023Quote: ... and TruSeq small RNA kit (Illumina, RS-200-0012). In the case of SILVER-seq ...
-
bioRxiv - Immunology 2023Quote: ... using the NovaSeq6000 S2 or S4 Reagent kit (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were prepared from TrueSeq Stranded RNA Kit (Illumina) and sequenced on Illumina instruments ...
-
bioRxiv - Cell Biology 2023Quote: ... and then used Illumina TruSeq RNA prep kit (Illumina) to establish libraries which were sequenced with Illumina HiSeq400 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the Illumina TruSeq Kit (Illumina #RS-122-2001) was used to generate sequencing libraries ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... using the TruSeq Nano DNA Library Preparation Kit (Illumina). The library was sequenced on an Illumina NovaSeq 6000 machine ...
-
bioRxiv - Genomics 2024Quote: ... using the MiSeq Reagent Kit v2 500-cycles (Illumina). All isolates included in this study are summarised in Supplementary Table 1.
-
bioRxiv - Genomics 2024Quote: ... using a 100-cycle S2 Kit or NextSeq2000 (Illumina) using a 100-cycle P3 kit (ATAC ...
-
bioRxiv - Immunology 2024Quote: ... libraries were generated with the Nextera XT kit (Illumina) using 500 pg of cDNA as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... using the NextSeq 300-cycle high output kit (Illumina) to generate 2 × 151 bp paired-end reads.
-
bioRxiv - Molecular Biology 2024Quote: ... followed by a TruSeq Stranded Total RNA Kit (Illumina). Libraries were sequenced on a HiSeq 4000 (Illumina ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The TruSeq Stranded mRNA Sample Prep kit (Illumina, CA) was used to create RNAseq libraries ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were prepared using the VeriSeq PGS Kit (Illumina) or the NEB Ultra II FS Kit according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and the TruSeqStranded mRNA library prep kit (Illumina Inc), following the Ribo-Zero rRNA Removal kit Reference guide and the “TruSeqStranded mRNA Sample Preparation Guide ...
-
bioRxiv - Immunology 2023Quote: ... with a MiSeq Reagent Kit v3 (600-cycle) (Illumina).
-
bioRxiv - Neuroscience 2023Quote: ... using a NovaSeq 6000 S2 Reagent Kit v1.5 (Illumina) according to the manufacturers instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and NovaSeq S1 Reagent Kit v1.5 (cat# 20028319, Illumina).
-
bioRxiv - Microbiology 2024Quote: ... using the Nextera XT DNA Library Preparation kit (Illumina) (Data set S1 ...
-
bioRxiv - Microbiology 2024Quote: ... with the Illumina Truseq Stranded RNA LT kit (Illumina) or Zymo-Seq RiboFree Total RNA Library Kit (Zymo Research)(Data set S1) ...
-
bioRxiv - Immunology 2024Quote: ... Libraries were prepared using TruSeq stranded mRNA kit (Illumina) and sequenced in a HISeq 3000 (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... For library preparation the TruSeq Stranded mRNA kit (Illumina) was selected and sequenced on a NextSeq 500 (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... using a 75 base pair cycle sequencing kit (Illumina) and a paired-end run with the following run parameters ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by a TruSeq Stranded Total RNA Kit (Illumina).
-
bioRxiv - Microbiology 2019Quote: ... The PCR-generated amplicon libraries were subjected to 250 nt paired-end sequencing on a MiSeq platform (Illumina, San Diego, CA, USA).
-
bioRxiv - Cancer Biology 2022Quote: ... an equal combination of additional PCR products containing two inverse barcodes (GACTCAGTGTCAGACTGAGTGTCTGACTGT and CTGAGTCACAGTCTGACTCACAGACTGACA) plus the PhiX Control V3 (Cat. FC-110-3001, Illumina, CA, USA) were spiked in to balance the nucleotide distribution within the library ...
-
bioRxiv - Genomics 2022Quote: ... USA) for short read sequencing as specified in the TruSeq DNA PCR-Free Reference Guide (Oct 2017, Illumina, San Diego, CA, USA). A library was prepared using a TruSeq DNA PCR-Free library preparation kit according to manufacturer guidance and was sequenced on a NextSeq500 instrument (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... Sequence libraries of the V1 and V3 region of the 16S rRNA genes from each of the samples were constructed in accordance with the Dual Barcoded Two-Step PCR procedure from Illumina (Illumina, 2013). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: ... and PCR and sequencing were performed as described previously (2 x 250bp paired-end reads, on an Illumina Miseq (Lemont, IL, USA)) [68–70] ...
-
bioRxiv - Microbiology 2022Quote: ... in a 100 µl reaction with 2 µl gDNA (∼100 ng) and primers oJMP697 and oJMP698 (nested primers with adapters for index PCR with Illumina TruSeq adapter) according to the manufacturer’s protocol using a BioRad C1000 thermalcycler with the following program ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... although sequence data for each isolate is derived from pools of individuals (except from PCR-free Illumina sequence data for S. avenae), all individuals sequenced for a given isolate are expected to contain the same two haplotypes and so sequence data can be combined to reconstruct fully phased haplotypes for each isolate.
-
bioRxiv - Systems Biology 2023Quote: ... in a 100 µl reaction with 2 µl gDNA (∼100 ng) and primers oJMP697 and oJMP698 (nested primers with adapters for index PCR with Illumina TruSeq adapter) according to the manufacturer’s protocol using a BioRad C1000 thermocycler with the following program ...
-
bioRxiv - Genetics 2023Quote: ... in a 100 µl reaction with 2 µl gDNA (∼100 ng) and primers oJMP697 and oJMP698 (nested primers with partial adapters for index PCR with Illumina TruSeq adapter) according to the manufacturer’s protocol using a BioRad C1000 thermal cycler with the following program ...