Labshake search
Citations for Illumina :
1551 - 1600 of 2469 citations for 7 Diethylamino 3 5 6 dimethyl 2 benzoxazolyl 2H 1 benzopyran 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2023Quote: ... One hundred nanograms of DNA obtained from tails were used for library preparation with a TruSeq DNA Nano kit (Illumina). Libraries were sequenced on the NovaSeq 6000 platform (2 x 150 bp ...
-
bioRxiv - Molecular Biology 2023Quote: ... was used to prepare a whole-transcriptome sequencing library and sequenced on one lane of a NovaSeq 6000 SP (Illumina) machine.
-
bioRxiv - Genetics 2023Quote: ... and the pool was sequenced on one lane of the Illumina HiSeq 4000 sequencer with a 75 bp Paired-End SBS chemistry (Illumina).
-
bioRxiv - Neuroscience 2023Quote: ... The uniquely barcoded libraries were multiplexed onto one lane and 100-bp paired-end deep sequencing was carried out at the HiSeq 4000 (Illumina) generating ∼20 million reads per sample.
-
bioRxiv - Molecular Biology 2023Quote: ... we used one lane of a NovaSeq 6000 SP Reagent Kit v1.5 (100 cycles) (Illumina, San Diego, CA, USA, 20028401) (Illumina ...
-
bioRxiv - Biochemistry 2023Quote: ... The final clone was confirmed to have two copies or the DNMT3AR882H allele and one copy of the DNMT3AWT allele by Illumina amplicon sequencing (Figure S1).
-
bioRxiv - Genomics 2023Quote: ... Each pool of libraries was sequenced independently by method on one lane of a NovaSeq6000 S Prime (SP) flowcell (Illumina), for three SP lanes in total ...
-
bioRxiv - Microbiology 2021Quote: ... with 5% (v/v) 20 pM PhiX (Illumina), using 150 cycle v3 cartridges ...
-
bioRxiv - Genomics 2019Quote: ... low call rate (> 5% low quality data [Illumina detection P>1×10−6 ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2023Quote: ... In each sequencing run 5% of PhiX (Illumina) was included as an internal control ...
-
bioRxiv - Immunology 2019Quote: ... The indexed samples were multiplexed per 4 or 6 and sequenced on a HiSeq2500 sequencer (Illumina) to produce single-ends 65 bases reads ...
-
bioRxiv - Cancer Biology 2019Quote: ... 0.75 nM libraries were pooled in 6-plex and sequenced on a HiSeq X Ten (Illumina) to produce paired-end 150 bp reads ...
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... corresponding to either the Australian or American samples were pooled and run on 7 lanes of the Illumina NextSeq 500 sequencer (Illumina, San Diego, USA) in 75bp paired-end reads mode.
-
bioRxiv - Molecular Biology 2020Quote: ... was performed using the SureCell WTA 3’ library prep kit (Illumina, 20014279) according to manufacturer’s instructions with minor modifications ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... using 300-cycle kit (v.3, Illumina, Inc., San Diego, CA, USA) to obtain 150 bp paired-end reads.
-
bioRxiv - Neuroscience 2021Quote: ... 3′ gene expression libraries were dual-index sequenced using NextSeq 150bp (Illumina) flow cells by the Duke Center for Genomic and Computational Biology Core Facility.
-
bioRxiv - Cell Biology 2021Quote: ... The final constructed 3’- biased single cell libraries were sequenced by Illumina Nextseq500 machine ...
-
bioRxiv - Immunology 2022Quote: ... and mixed with 3 μl of Illumina TDE1 Tn5 transposase (Illumina, 15027916). Transposition was performed by incubating the prepared reactions on a C1000 Touch thermal cycler with 96–Deep Well Reaction Module (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... or matched the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Microbiology 2023Quote: ... or matching the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Genetics 2023Quote: ... The final constructed 3’-biased single cell libraries were sequenced by Illumina Novaseq6000 machine ...
-
bioRxiv - Developmental Biology 2023Quote: ... distributed over 3 lanes of a HiSeq 2500 with v4 chemistry (Illumina). Sequencing was performed by the Next Generation Sequencing Facility at Vienna BioCenter Core Facilities (VBCF) ...
-
bioRxiv - Plant Biology 2019Quote: ... The Hi-C libraries were sent to the Australian Genome Research Facility (Melbourne, Australia) for sequencing using one lane of 100 bp PE sequencing using a HiSeq2000 (Illumina Inc.).
-
bioRxiv - Plant Biology 2021Quote: One microgram of total RNA was used to generate RNA-seq libraries using TruSeq Stranded mRNA Library Prep Kit (Illumina Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... a total of 2.58 × 108 assembled paired-end reads was obtained as two 33 Gb FastQ files (one file per Illumina-sequence lane). The sequence quality was evaluated by means of the FastQc software (Andrews ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Paired-end sequencing with 150 cycles for each side of the fragments was performed in one lane of the MiSeq® System (Illumina).
-
bioRxiv - Developmental Biology 2021Quote: ... parental DNA was extracted from one individual male and female from tail-fin clip and sequencing library were synthesized with Nextera XT Kit (Illumina, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... The short-read paired-end libraries were sequenced in two independent lanes and the mate-pair library in one lane using the Illumina HiSeq4000 platform (Illumina, USA). The library’s construction and sequencing were performed by Hokkaido System Science Co ...
-
bioRxiv - Genomics 2021Quote: Microarray-derived SNP genotypes were available for 30,499 BSW cattle typed on seven low-density (20k-150k) and one high-density chip (Illumina BovineHD; 777k). Coordinates of the SNP were originally determined according to the ARS-UCD1.2 build ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were then barcoded and pooled into two lanes (eight samples in one and two in another) to generate 100bp paired-end reads on the HiSeq1500 sequencer (Illumina, Inc.).
-
bioRxiv - Neuroscience 2022Quote: ... We pooled up to 12 samples (with different barcodes) in one lane of a flow cell for sequencing (Illumina HiSeq 2500) and used a 150 bp paired-end read configuration ...
-
bioRxiv - Genomics 2022Quote: ... The final Hi-C DNA-Seq library was submitted to Novogene (www.en.novogene.com) for one lane of PE150 Illumina HiSeq X-Ten (Illumina, San Diego, CA, USA) sequencing.
-
bioRxiv - Genomics 2022Quote: ... These products were then used for index PCR using the SI-PCR Primer from the 10X kit for the i5 and one of the small RNA TrueSeq index primers for the i7 (Illumina #15004197).
-
bioRxiv - Evolutionary Biology 2023Quote: ... We then sequenced the entire pooled library on one lane of a NovaSeq6000 SP flowcell (2x150bp; Illumina, Inc. San Diego, CA) at the University of Iowa Institute of Human Genetics.
-
bioRxiv - Genomics 2023Quote: ... Libraries were pooled and sequenced (2x150nt) on one lane of a S1 flowcell on the NovaSeq 6000 (Illumina, San Diego, CA). FastQ files were generated and demultiplexed with the bcl2fastq v2.20 Conversion Software (Illumina).
-
bioRxiv - Genetics 2019Quote: Genotype information was available for 21,001 NTR participants from 6 different genotyping arrays (Affymetrix 6.0 [N = 8,640], Perlegen-Affymetrix [N = 1,238], Illumina Human Quad Bead 660 [N = 1,439] ...
-
bioRxiv - Cell Biology 2023Quote: ... and 20 μM reverse P7 primers with 6-bp TruSeq indices that are automatically demultiplexed by Illumina software ...
-
bioRxiv - Developmental Biology 2022Quote: ... All 6 individual libraries were pooled in equal amount and sequenced with the HiSeq 4000 platoform (Illumina). The RNA-seq data are available under the GEO accession no ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 12.5 pmol each of the following Illumina primers: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG ATCT and 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCT (the underlined parts will hybridize to the two Illumina flowcell oligos). Temperature cycling consisted of 72 ◻C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Illumina sequencing libraries were generated for 5 αHHβHH mice and 5 αLLβHL mice using TruSeq RNA Sample Preparation Kit v2 (Illumina, San Diego, CA, USA) and sequenced on an Illumina HiSeq2500 platform ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl water) with 2.5 µl transposase (Illumina 20034197) for 30 min at 37 °C with shaking at 1000 r.p.m ...
-
bioRxiv - Neuroscience 2020Quote: ... An additional 5 samples were sequenced on MiSeq (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... spiked with 5% PhiX pre-made library from Illumina and loaded on a Miseq v3 kit (Illumina Inc. ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl PPC (Illumina Nextera DNA Sample Preparation Kit) and 20 μl DNA ...
-
bioRxiv - Immunology 2022Quote: ... mixed with 5% PhiX and sequenced on MiSeq (Illumina) using MiSeq V3 2 × 300 cycle kit (Illumina).
-
bioRxiv - Genomics 2023Quote: ... 5 µL Tn5 transposase (Illumina Cat FC-121-1030) and 22,5 µL nuclease-free H2O and incubated at 37 °C for 30 mins ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% PhiX control (Illumina, San Diego, CA, USA) along with positive (DNA sample extracted from the healthy gut ...