Labshake search
Citations for Illumina :
1451 - 1500 of 9201 citations for ssc mir 758 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... 500 ng total RNA from each sample were used to make library according to the product guide of stranded mRNA library kit (E4720L; NEBNext Ultra™ Directional RNA Library Prep Kit for Illumina). In short ...
-
bioRxiv - Genomics 2023Quote: ... 200ng alkylated RNA were used as input for generating 3’-end mRNA sequencing libraries using a commercially available kit (QuantSeq 3ʹ mRNA-Seq Library Prep Kit FWD for Illumina, Lexogen).
-
bioRxiv - Cell Biology 2020Quote: ... an oligonucleotide containing the Illumina P7 adaptor sequence was ligated to the 3’ end of the single stranded LAM PCR fragments using Circligase (Epicentre/Illumina, #CL9025K). A P5 adaptor was added by PCR ...
-
bioRxiv - Cell Biology 2020Quote: ... Libraries were then indexed and PCR amplified (10 cycles) and sequenced on Illumina HiSeq 2500 sequencing platform following the manufacture’s protocols (Illumina, Hayward CA.).Sequence reads were aligned to GRCh37-lite using Burrows-Wheeler Aligner (BWA ...
-
Evolutionary stasis of an RNA virus indicates arbovirus re-emergence triggered by accidental releasebioRxiv - Evolutionary Biology 2019Quote: ... dual indexed libraries were PCR amplified and the purified PCR products were pooled in equimolar concentrations and sequenced using 150 paired end sequencing on MiSeq or NextSeq500 sequencers (Illumina USA).
-
bioRxiv - Immunology 2020Quote: ... PCR amplicons were sequenced on an Illumina MiSeq instrument (v2 chemistry, 150 bp paired end reads) (Illumina, San Diego, CA, USA). Data were analyzed using a custom-built pipeline ...
-
bioRxiv - Plant Biology 2020Quote: ... TruSeq PCR-Free Low Throughput libraries were prepared for each DNA sample following the manufacturer’s instructions (Illumina, San Diego, CA, USA). Each sample had a unique index from Illumina TruSeq DNA CD Indexes (96 indexes/samples) ...
-
bioRxiv - Cell Biology 2022Quote: ... Purified tagmented DNA was amplified with KAPA HIFI polymerase (12 PCR cycles) and Unique Dual Primers from Illumina (Cat number 20332088). Size-selection (L:1.1 ...
-
bioRxiv - Immunology 2020Quote: ... The second round PCR (8 cycles, 70°C annealing temperature) was performed using Nextera XT index primers (Illumina, FC-131-2001) which introduce 8 base pair indices on the 5’ and 3’ termini of the amplicon for data demultiplexing of each sample screened ...
-
bioRxiv - Microbiology 2020Quote: ... PCR-generated amplicon libraries were subjected to 250 nt paired-end sequencing on a MiSeq platform (Illumina, San Diego, CA, USA).
-
bioRxiv - Evolutionary Biology 2019Quote: We assessed input gDNA quantity using Qubit and normalised the samples to 20ng/ul as described in TruSeq®DNA PCR-Free Library Prep Reference Guide (#FC-121-3001, Illumina) prior fragmentation to 350bp with Covaris S2 ...
-
bioRxiv - Genetics 2019Quote: ... Illumina sequencing adapters were added by PCR using 12 cycles of amplification (Illumina Cat. FC-131-1024 and FC-131-2001). Final sequencing libraries were purified and size selected using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2021Quote: ... A 50µl aliquot of the final pooled PCR product was sequenced at the UC Davis Genome Center DNA Technologies Core via the Illumina MiSeq PE250 platform (Illumina, CA).
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... RNA fragmentation was performed at 94°C for 6 minutes and 10 PCR cycles were used during library amplification with TruSeq single-index adapters (Illumina, #20020492). Final library concentrations were quantified with both Qubit fluorometric quantification (DNA dsDNA HS kit ...
-
bioRxiv - Genomics 2020Quote: ... the fragmented amplicons were cleaned-up and amplified by 5 cycles of PCR using specific index adapters for Illumina sequencing (Nextera™ DNA CD Indexes, Illumina) (Supplementary Figure 1B) ...
-
bioRxiv - Immunology 2022Quote: ... The PCR product library was quantitated and subjected to sequencing on an Illumina MiSeq sequencer (Illumina, San Diego, CA 92122 USA). HLA alleles and genotypes were called using the Omixon HLA Explore (version 2.0.0 ...
-
bioRxiv - Bioengineering 2022Quote: ... The primers T7_Endo_Lib_LONG_FOR GCCCTCTGTGTGAATTCT and T7_Endo_Lib_LONG_REV GTCACCGACACAAGCTTA were used and a second round of PCR was carried out with the IDT for Illumina UD indexes (Illumina Corp.) to add adapter tags ...
-
bioRxiv - Genomics 2022Quote: ... After purifying the Sample Tag PCR1 product indexing PCR was done following instructions of the MULTI-seq protocol where small RNA TrueSeq indexing primers (Illumina #15004197) were used for i7 and the Forward Primer from the BD WTA kit was used for i5.
-
bioRxiv - Immunology 2022Quote: ... multiplex PCR was used to amplify rearranged VDJ sequences followed by high throughput sequencing using Illumina technologies (Illumina, San Diego, CA). PCR amplification bias was minimized by internal controls in the ImmunoSEQ assay29 ...
-
bioRxiv - Immunology 2022Quote: ... and PCR products were sent to the @BRIDGe platform for sequencing on an Illumina MiSeq platform (Illumina, San Diego, CA, USA).
-
bioRxiv - Microbiology 2022Quote: ... the index PCR step was performed as in the protocol except using IDT for Illumina DNA/RNA UD Indexes Set A (Illumina, 20027213), MyFi Mix (BIOLINE ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl of PCR 1 were used as template for PCR 2 (14 cycles) and used forward primers 5’-AATGATACGGCGACCACCGAGATCTACAC-NNNNNNNN-ACACTCTTTCCCTACACGAC-3’ (compatible to Illumina i5) and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7) ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR-amplified libraries were quantified on a Bioanalyser and appropriately diluted and multiplexed for deep sequencing (Illumina MiSeq 2×75 bp).
-
bioRxiv - Microbiology 2023Quote: ... Equal amounts of PCR product (2 µl 4nM) were pooled and sequenced on an Illumina MiSeq Sequencer (Illumina, San Diego, USA) using a paired-end 300bp V3 kit at Utrecht Sequencing Facility (www.useq.nl).
-
bioRxiv - Systems Biology 2023Quote: ... Indexed PCR primers were synthesized by Integrated DNA Technologies using the standard 8nt indexes from Illumina (D501-D508 and D701-D712) as follows:
-
bioRxiv - Systems Biology 2023Quote: ... Indexed PCR primers were synthesized by Integrated DNA Technologies using the standard 8nt indexes from Illumina (D501-D508 and D701-D712). The sequences for the primer sets were used for the libraries cloned into pRDA-052 or pRDA-550 are listed below:
-
bioRxiv - Genetics 2022Quote: ... and hMT-2_R (GGCAGGTCAATTTCACTGGT)] and the library preparation of the LR-PCR products of hMT1 and hMT2 primers was conducted using DNA Prep Tagmentation (Illumina Inc.). This approach allows the fragment size of the tagmented LR-PCR products to be evenly 300 bp ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were then indexed and PCR amplified (10 cycles) and sequenced on Illumina HiSeq 2500 sequencing platform following the manufacture’s protocols (Illumina, Hayward CA).
-
bioRxiv - Biochemistry 2024Quote: ... Purified tagmented DNA was amplified with KAPA HIFI polymerase (12 PCR cycles) and Unique Dual Primers from Illumina (Cat number 20332088). Size-selection (L:1.1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and ribosomal RNA was removed using the Ribo-Zero™ Magnetic Core Kit and Ribo-Zero™ rRNA Removal kit (Illumina, USA), according to the manufacturers’ protocols ...
-
bioRxiv - Microbiology 2019Quote: ... DNA libraries were prepared for equimolar-pooling using Nextera DNA Library Preparation Kit and Nextera Index Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Genomic DNA libraries were created using the Nextera XT library preparation kit and Nextera XT index kit v2 (Illumina, San Diego, CA) and sequencing was performed using 2×250-bp dual-index runs on an Illumina MiSeq at the University of Minnesota Mid-Central Research and Outreach Center (Willmar ...
-
bioRxiv - Pathology 2022Quote: ... The RNA of the extracted sample was used to build a cDNA library by a reverse transcription kit based on the manufacturer’s instruction (NEBNext® Ultra™ RNA Library prep Kit for Illumina®).
-
bioRxiv - Microbiology 2021Quote: ... The QIAseq FastSelect 5S/16S/23S rRNA removal kit was used to treat samples prior to library prep with the TruSeq Stranded Total RNA Library Prep Kit (Illumina, CA, USA). Sequencing was conducted on the Illumina HiSeq 4000 at 50 bp single-end reads.
-
bioRxiv - Bioengineering 2022Quote: Total RNA was extracted from iPSC-CM monolayers using a Qiagen RNeasy Micro kit and prepared for sequencing at 100 ng with a Stranded Total RNA Prep kit (Illumina Inc., USA), and bulk-sequenced at the Princess Margaret Genomics Center (Toronto ...
-
bioRxiv - Neuroscience 2023Quote: ... Ribosomal depleted RNA-seq libraries were prepared using the TruSeq® Stranded Total RNA Library Prep Kit Human/Mouse/Rat kit (Illumina, 20020596) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sequencing was performed using a NextSeq 500/550 High Output Kit v2.5 (75 Cycles) kit (cat# 20024906) on an Illumina Sequencing NextSeq 550 System ([RRID: SCR_016381], Illumina, San Diego, CA, USA). The initial annotated dataset went through quality control (QC ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA was treated with the QIAseq FastSelect 5S/16S/23S rRNA removal kit prior to library prep with the TruSeq Stranded Total RNA Library Prep Kit (Illumina, CA, USA). The Illumina HISeq 4000 was used for sequencing at 50bp single-end reads.
-
bioRxiv - Neuroscience 2023Quote: ... RNA-seq libraries were prepared from 600ng of total RNA using the TruSeq® Stranded mRNA Library Prep kit and the TruSeq® RNA Single Indexes kits A and B from Illumina. The library quality and quantity were checked using an Agilent 2100 Bioanalyzer and a Qubit dsDNA HS Assay Kit ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... which were the Infinium Global Screening Array-24 Kit™ (GSA24) and the Infinium Global Diversity Array-8 Kit™ (GDA8) from Illumina and the Axiom™ Genome-Wide Human Origins (HO ...
-
bioRxiv - Plant Biology 2020Quote: ... Ribo-Zero kit (Epicentre, an Illumina company, Madison, WI) was used to remove rRNA from the libraries ...
-
bioRxiv - Microbiology 2020Quote: ... libraries were prepared using the Nextera XT kit (Illumina) at 1/12th reaction size with a TTP LabTech mosquito® HV liquid handling robot ...
-
bioRxiv - Genetics 2021Quote: ... rRNA was removed using the Ribo-Zero kit (Illumina) and stranded RNA-seq libraries were prepared using random hexamer and NEB directional RNA library prep kit (NEB ...
-
bioRxiv - Genomics 2021Quote: ... The TruSeq DNA Nano Sample Prep Kit v2 (Illumina) was used in subsequent steps of library preparations ...
-
bioRxiv - Molecular Biology 2021Quote: ... then treated with RiboZero Magnetic Gold (Yeast) Kit (Illumina) as described previously30 ...
-
bioRxiv - Developmental Biology 2021Quote: ... using the NextSeq500/550 High Output v2.5 Kit (Illumina). The sequence reads were aligned against GRCh38 genome assembly using the cellranger count command of Cell Ranger (version 4.0.0 ...
-
bioRxiv - Developmental Biology 2021Quote: ... using the Nextera XT DNA Library Preparation Kit (Illumina #FC-131-1096 ...
-
bioRxiv - Developmental Biology 2021Quote: ... A Nextera XT DNA Library Preparation Kit (Illumina, Inc.) was used to generate indexed 2×75bp paired-end cDNA libraries for subsequent sequencing on NextSeq 500 sequencing platform (Illumina ...
-
bioRxiv - Developmental Biology 2021Quote: ... Libraries were then generated using the Nextera kit (Illumina) and 75bp single end read-sequencing was carried out.
-
bioRxiv - Developmental Biology 2020Quote: ... using the Nextera DNA Flex library prep kit (Illumina) to create a library from full-length cDNA ...