Labshake search
Citations for Illumina :
101 - 150 of 970 citations for VEGFR2 Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... and 2.5 µl of Tn5 Transposase (Illumina FC-121-1030) were added ...
-
bioRxiv - Genetics 2023Quote: ... 5 μl Nextera XT V2 Index (Illumina, FC-131-2001) primer N7xx ...
-
bioRxiv - Genetics 2023Quote: ... The pooled library and PhiX library (Illumina, FC-110-3001) were denatured with 0.2 M NaOH separately and diluted with pre-chilled HT1 to 12 pM ...
-
bioRxiv - Immunology 2024Quote: ... transposition was performed using the kit (Illumina, #FC-121-1030). DNA was then amplified using NEBNext High Fidelity 2X PCR Master Mix (New England Biolabs ...
-
bioRxiv - Cancer Biology 2019Quote: Whole-genome libraries were generated using either the Illumina TruSeq DNA LT sample preparation kit (Illumina, Part no. FC-121–2001 and FC-121–2001) or the Illumina TruSeq DNA PCR-free LT sample preparation kit (Illumina ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 1 μl of each Nextera XT Index Kit v2 set B or set C barcoding primer (Illumina, Cat# FC-131-2002 or FC-131-2003). These reactions were then incubated at 95°C for 15 minutes ...
-
bioRxiv - Genomics 2020Quote: ... The cells were transposed with Illumina transposase (Illumina #FC-121-1030) for 30 minutes at 37°C while shaking at 250 RPM ...
-
bioRxiv - Genomics 2020Quote: Libraries were generated via tagmentation of cDNA (Illumina FC-121-1030) and sequenced ...
-
bioRxiv - Neuroscience 2020Quote: ... using Nextera XT Index Kit V2 (Illumina Cat# FC-131-2001) and a custom index set (Integrated DNA Technologies) ...
-
bioRxiv - Neuroscience 2020Quote: ... using Nextera XT Index Kit V2 (Illumina Cat# FC-131-2001) and a custom index set (Integrated DNA Technolgies) ...
-
bioRxiv - Genomics 2021Quote: ... using the Illumina NexteraXT kit (FC-131-1024, Illumina, California, USA). The Pooled NexteraXT libraries were loaded onto an Illumina NextSeq 550 system in house at IISER ...
-
bioRxiv - Cancer Biology 2020Quote: ... with NextSeq75 High Output v2 kit (Illumina, cat# FC-404-2005). Raw fastq files were aligned to the human GRCH38 genome by using bowtie 2 [39] ...
-
bioRxiv - Neuroscience 2021Quote: ... The Nextera XT DNA Library Prep Kit (Illumina FC-131-1024) was used to tag ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA was then tagmented with Nextera Tn5 (Illumina FC-131-1024) and amplified/indexed by PCR with the NEBNext DNA Library Prep Kit (NEB E6040) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... we added 20 % PhiX Control v3 Library (Illumina, FC-110-3001). The overall read yield ranged between 150 - 300 million reads per HiSeq run.
-
bioRxiv - Neuroscience 2020Quote: ... the Nextera indices (12 pool-specific indices, Illumina, FC-131-2001) and 10 µM P5-TSO hybrid primer (5’-AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCA ACGCAGAGT*A*C-3’ ...
-
bioRxiv - Genomics 2020Quote: ... and library preparation (the Nextera index kit: FC-121-1011, Illumina). Libraries were purified using Agencourt AMPure XP beads (A63881 ...
-
bioRxiv - Genetics 2020Quote: ... or Nextera DNA Flex Library Prep Kit (Illumina FC-121-1030) in combination with the NeoPrep Library Prep System (Illumina ...
-
bioRxiv - Neuroscience 2020Quote: ... using Nextera XT Index Kit V2 (Illumina Cat# FC-131-2001) and custom index sets (Integrated DNA Technologies) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 19.5µl of nuclease-free water) (FC-121-1030, Illumina; G9441, Promega). Transposition reactions were incubated at 37°C for 30 minutes in an Eppendorf ThermoMixer with agitation at 1000 RPM ...
-
bioRxiv - Genetics 2023Quote: ... 10-20% PhiX control DNA (Illumina; cat. no. FC-110-3001) was spiked into the pooled 2 nM DNA amplicon library ...
-
bioRxiv - Genetics 2023Quote: ... 10-20% PhiX control DNA (Illumina; cat. no. FC-110-3001) was spiked into the pooled 2 nM DNA amplicon library ...
-
bioRxiv - Synthetic Biology 2023Quote: ... using its Nextera XT DNA Library Kit (Illumina #FC-131- 001) to prepare the samples for sequencing in an Illumina MiSeq (Figure S2) ...
-
bioRxiv - Genomics 2023Quote: ... and 5 μl of Tagment DNA Buffer (Illumina, FC-131-1096) and incubated at 55°C for 5 minutes ...
-
bioRxiv - Genomics 2023Quote: ... and Nextera XT Index Kit v2 (Illumina, FC-131-2001/2002). 4 μl of 1 ng amplicon DNA was combined with a mix containing 1 μl of Amplicon Tagment Mix (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... and sequenced using High Output Sequencing Kits (Illumina FC-420-1003) on an Illumina MiniSeq instrument.
-
bioRxiv - Cell Biology 2022Quote: ... Primers were from the Nextera Index kit (Illumina FC-121-1011), using 2.5μl of an i5 primer and 2.5μl of an i7 primer per PCR ...
-
bioRxiv - Genomics 2023Quote: ... and 2.5μl of each Index primer i7 (Illumina, FC-1312001/2002) and Index primer i5 (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... Nuclei were resuspended in 1X TD Buffer (Illumina FC-121-1030) and 2.5 µl of Tn5 Transposase (Illumina FC-121-1030 ...
-
bioRxiv - Genomics 2024Quote: ... 2.5 µl Tn5 Transposase (Illumina, 20034197 Cat #FC-121–1030, Nextera) and Nuclease Free H2O ...
-
bioRxiv - Genomics 2024Quote: ... Illumina Nextera XT DNA Libraries were prepared (Illumina, FC-131-1096) and sequenced (Illumina HiSeq 4000 ...
-
bioRxiv - Systems Biology 2024Quote: ... and mixed with hydrolyzed PhIX control library (Illumina FC-110-3001). The final product contained 1.8 pM library with 30% PhIX/70% sample in 1.3 ml HT1 buffer ...
-
bioRxiv - Cancer Biology 2020Quote: ... The PCR-amplified cDNA was purified using AMPure XP beads and processed with the Nextera XT DNA Library Preparation Kits (Illumina, Cat. # FC-131-1024 and FC-131-1096) as per the protocol provided by the manufacturer.
-
bioRxiv - Microbiology 2021Quote: ... Nextera XT indices were used to generate libraries from 1 ng of cDNA material for each sample following the instructions provided by Illumina (Illumina FC-131-1096 and FC-131-2001). Library preparations were purified using AMPure XP beads and checked for quality using the Agilent Bioanalyzer at Stanford Functional Genomics Facility (SFGF) ...
-
bioRxiv - Immunology 2021Quote: ... Libraries were barcoded with the Illumina Nextera XT (FC-131-1096, Illumina) and pooled ...
-
bioRxiv - Genetics 2021Quote: ... with the incorporation of Illumina Nextera XT adaptors (Illumina, FC-131-1001). The libraries were then size selected with AmpureXP Beads (Beckman ...
-
bioRxiv - Neuroscience 2022Quote: ... For tagmentation the Nextera DNA Sample Preparation kit (FC-131-1096, Illumina) was used and final PCR was performed as follows ...
-
bioRxiv - Genomics 2019Quote: ... 4 ng ChIP DNA was incubated with transposase (Illumina, Fc-121-1030) for 10’ at 55’C ...
-
bioRxiv - Genomics 2021Quote: ... libraries were prepared using the Nextera XT Kit (Illumina, FC-131-1096). This included the RNA extraction experiments (Figure 4 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1% Igepal) and tagmented using Nextera DNA kit (Illumina FC-121-1030) (tagmentation −0.7 μl of Tn5 enzyme in 10 μl reaction ...
-
bioRxiv - Neuroscience 2020Quote: ... using NextSeq500 High-Output v2 75 cycles consumables (FC-404-2005; Illumina). Libraries were sequenced 75 cycles using single-ended reads with 6 additional reads for barcodes ...
-
bioRxiv - Cancer Biology 2022Quote: ... at half reaction volume followed by Nextera XT (Illumina FC-131-1024) library preparation ...
-
bioRxiv - Cancer Biology 2022Quote: ... at half reaction volume followed by Nextera XT (Illumina FC-131-1024) library preparation ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... we use standard Nextera XT Index v2 primers (Illumina #FC-131-2004) to further label samples representing different conditions and timepoints with unique identifiers that allow for multiplexing on the same sequencing lane ...
-
bioRxiv - Microbiology 2019Quote: ... the Illumina Nextera XT DNA Library Prep Kit (Illumina, FC-131-1096) was used for library preparation ...
-
bioRxiv - Genomics 2019Quote: ... and the TruSeq SBS HS Kit v3200 cycles (Illumina FC-401-3001), generating 2 × 125 bp.
-
bioRxiv - Molecular Biology 2020Quote: ... Nuclear pellets were treated with Nextera Tn5 Transposase (Illumina, FC-121-1030) in a 50 μl reaction for 30 min at 37 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... All samples proceeded through Nextera XTDNA Library Preparation (Illumina FC-131-1096) using either Nextera XT Index Kit V2 Sets A-D (FC-131-2001 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The Nextera XT Library Prep Kit (Illumina, cat. No. FC-131-1096) protocol was used for fragmentation and unique barcoding of the cDNA libraries ...
-
bioRxiv - Immunology 2021Quote: ... using the Nextera XT DNA Library Preparation Kit (Illumina, #FC-131-1096) and the Nextera Index Kit v2 Set A (Illumina ...