Labshake search
Citations for Illumina :
101 - 150 of 1014 citations for Tick Borne Encephalitis Virus Envelope Protein Human Fc tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... using a Nextera XT Index Kit (Illumina, FC-131-1002) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... 2.5⍰μl Tn5 Transposase (Illumina Cat #FC-121-1030, Nextera) and Nuclease Free H2O ...
-
bioRxiv - Genetics 2020Quote: ... 10 μL 2x tagmentation buffer (Illumina, Cat. FC-121-1031), and 1 μL of 8 μM loaded indexed transposase was added per well (See Picelli et al ...
-
bioRxiv - Genomics 2022Quote: ... Nextera XT DNA Library Prep Kit (Illumina, #FC-131-1096) was used for the tagmentation of 600 pg of cDNA ...
-
bioRxiv - Systems Biology 2022Quote: ... pooled with 15% PhiX Control v3 (Illumina #FC-110-3001), and sequenced one of the following ways ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5 µl Tagment DNA Enzyme 1 (FC-121-1030, Illumina) was added to the 10uL suspension ...
-
bioRxiv - Systems Biology 2022Quote: ... Nextera XT Index Kit protocol (Illumina, Cat#FC-131– 1024) was used to add indices and Illumina sequencing adapters to each PCR sample ...
-
bioRxiv - Genomics 2023Quote: ... followed by adding 60 μl NPM (Illumina, FC-131-1096), 12 μl 10 μM Indexed Nextera P5 primer ...
-
bioRxiv - Genomics 2023Quote: ... followed by adding 15 μl NPM (Illumina, FC-131-1096), 3 μl 10 μM Indexed Nextera P7 primer ...
-
bioRxiv - Neuroscience 2023Quote: Nextera XT DNA Sample Prep Kit (Illumina FC-131-1096) was used at 1/10 of recommendation volume ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 0.5 µl Tagment DNA Enzyme 1 (FC-121-1030, Illumina) was added to the 10µl suspension ...
-
bioRxiv - Systems Biology 2023Quote: ... 2µL each i5 and i7 primers (Illumina #FC-131-2001), and 25µL NEBNext High Fidelity 2X Master Mix (NEB #M0541S ...
-
bioRxiv - Microbiology 2023Quote: ... and Nextera XT Index Kit v2 (Illumina, FC-131-2001). The pooled library was sequenced on MiSeq platform (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... and 2.5 µl of Tn5 Transposase (Illumina FC-121-1030) were added ...
-
bioRxiv - Genetics 2023Quote: ... 5 μl Nextera XT V2 Index (Illumina, FC-131-2001) primer N7xx ...
-
bioRxiv - Genetics 2023Quote: ... The pooled library and PhiX library (Illumina, FC-110-3001) were denatured with 0.2 M NaOH separately and diluted with pre-chilled HT1 to 12 pM ...
-
bioRxiv - Immunology 2024Quote: ... transposition was performed using the kit (Illumina, #FC-121-1030). DNA was then amplified using NEBNext High Fidelity 2X PCR Master Mix (New England Biolabs ...
-
bioRxiv - Cancer Biology 2019Quote: Whole-genome libraries were generated using either the Illumina TruSeq DNA LT sample preparation kit (Illumina, Part no. FC-121–2001 and FC-121–2001) or the Illumina TruSeq DNA PCR-free LT sample preparation kit (Illumina ...
-
bioRxiv - Immunology 2021Quote: Virus stocks were sequenced using a MiniSeq platform (Illumina, Inc; San Diego, CA, USA). In brief ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The EcoT22I GBS libraries (now containing ID tags and Illumina flowcell adaptors) were purified again using the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 1 μl of each Nextera XT Index Kit v2 set B or set C barcoding primer (Illumina, Cat# FC-131-2002 or FC-131-2003). These reactions were then incubated at 95°C for 15 minutes ...
-
bioRxiv - Genomics 2020Quote: ... The cells were transposed with Illumina transposase (Illumina #FC-121-1030) for 30 minutes at 37°C while shaking at 250 RPM ...
-
bioRxiv - Genomics 2020Quote: Libraries were generated via tagmentation of cDNA (Illumina FC-121-1030) and sequenced ...
-
bioRxiv - Neuroscience 2020Quote: ... using Nextera XT Index Kit V2 (Illumina Cat# FC-131-2001) and a custom index set (Integrated DNA Technologies) ...
-
bioRxiv - Neuroscience 2020Quote: ... using Nextera XT Index Kit V2 (Illumina Cat# FC-131-2001) and a custom index set (Integrated DNA Technolgies) ...
-
bioRxiv - Genomics 2021Quote: ... using the Illumina NexteraXT kit (FC-131-1024, Illumina, California, USA). The Pooled NexteraXT libraries were loaded onto an Illumina NextSeq 550 system in house at IISER ...
-
bioRxiv - Cancer Biology 2020Quote: ... with NextSeq75 High Output v2 kit (Illumina, cat# FC-404-2005). Raw fastq files were aligned to the human GRCH38 genome by using bowtie 2 [39] ...
-
bioRxiv - Neuroscience 2021Quote: ... The Nextera XT DNA Library Prep Kit (Illumina FC-131-1024) was used to tag ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA was then tagmented with Nextera Tn5 (Illumina FC-131-1024) and amplified/indexed by PCR with the NEBNext DNA Library Prep Kit (NEB E6040) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... we added 20 % PhiX Control v3 Library (Illumina, FC-110-3001). The overall read yield ranged between 150 - 300 million reads per HiSeq run.
-
bioRxiv - Neuroscience 2020Quote: ... the Nextera indices (12 pool-specific indices, Illumina, FC-131-2001) and 10 µM P5-TSO hybrid primer (5’-AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCA ACGCAGAGT*A*C-3’ ...
-
bioRxiv - Genomics 2020Quote: ... and library preparation (the Nextera index kit: FC-121-1011, Illumina). Libraries were purified using Agencourt AMPure XP beads (A63881 ...
-
bioRxiv - Genetics 2020Quote: ... or Nextera DNA Flex Library Prep Kit (Illumina FC-121-1030) in combination with the NeoPrep Library Prep System (Illumina ...
-
bioRxiv - Neuroscience 2020Quote: ... using Nextera XT Index Kit V2 (Illumina Cat# FC-131-2001) and custom index sets (Integrated DNA Technologies) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 19.5µl of nuclease-free water) (FC-121-1030, Illumina; G9441, Promega). Transposition reactions were incubated at 37°C for 30 minutes in an Eppendorf ThermoMixer with agitation at 1000 RPM ...
-
bioRxiv - Genetics 2023Quote: ... 10-20% PhiX control DNA (Illumina; cat. no. FC-110-3001) was spiked into the pooled 2 nM DNA amplicon library ...
-
bioRxiv - Genetics 2023Quote: ... 10-20% PhiX control DNA (Illumina; cat. no. FC-110-3001) was spiked into the pooled 2 nM DNA amplicon library ...
-
bioRxiv - Synthetic Biology 2023Quote: ... using its Nextera XT DNA Library Kit (Illumina #FC-131- 001) to prepare the samples for sequencing in an Illumina MiSeq (Figure S2) ...
-
bioRxiv - Genomics 2023Quote: ... and 5 μl of Tagment DNA Buffer (Illumina, FC-131-1096) and incubated at 55°C for 5 minutes ...
-
bioRxiv - Genomics 2023Quote: ... and Nextera XT Index Kit v2 (Illumina, FC-131-2001/2002). 4 μl of 1 ng amplicon DNA was combined with a mix containing 1 μl of Amplicon Tagment Mix (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... and sequenced using High Output Sequencing Kits (Illumina FC-420-1003) on an Illumina MiniSeq instrument.
-
bioRxiv - Cell Biology 2022Quote: ... Primers were from the Nextera Index kit (Illumina FC-121-1011), using 2.5μl of an i5 primer and 2.5μl of an i7 primer per PCR ...
-
bioRxiv - Genomics 2023Quote: ... and 2.5μl of each Index primer i7 (Illumina, FC-1312001/2002) and Index primer i5 (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... Nuclei were resuspended in 1X TD Buffer (Illumina FC-121-1030) and 2.5 µl of Tn5 Transposase (Illumina FC-121-1030 ...
-
bioRxiv - Genomics 2024Quote: ... 2.5 µl Tn5 Transposase (Illumina, 20034197 Cat #FC-121–1030, Nextera) and Nuclease Free H2O ...
-
bioRxiv - Genomics 2024Quote: ... Illumina Nextera XT DNA Libraries were prepared (Illumina, FC-131-1096) and sequenced (Illumina HiSeq 4000 ...
-
bioRxiv - Systems Biology 2024Quote: ... and mixed with hydrolyzed PhIX control library (Illumina FC-110-3001). The final product contained 1.8 pM library with 30% PhIX/70% sample in 1.3 ml HT1 buffer ...
-
bioRxiv - Microbiology 2020Quote: ... The virus was passaged three times in VeroE6 cells and genotype sequence confirmed by Illumina sequencing ...
-
bioRxiv - Systems Biology 2021Quote: ... Final cDNA and sample tag libraries were sequenced on a NovaSeq 6000 (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... The BarSeq_P2 primer contains the tag that is used for demultiplexing by Illumina software ...