Labshake search
Citations for Illumina :
101 - 150 of 614 citations for Sulfur Free Cobalt Metallo Organic Standard Co @ 5000 µg g in Hydrocarbon Oil since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... We used the standard GenCall algorithm in GenomeStudio 2.0 (Illumina, Inc. San Diego, USA) following its best practices and criteria described earlier [18] ...
-
bioRxiv - Microbiology 2022Quote: ... following the standard TruSeq RNA Sample Prep Kit protocol (Illumina, San Diego, CA, USA). The cDNA library was sequenced on Illumina HiSeq 1500 system ...
-
Induction of telomerase in p21-positive cells counteracts capillaries rarefaction in aging mice lungbioRxiv - Molecular Biology 2022Quote: ... libraries are prepared following standard Illumina protocol and sequenced on a NovaSeq sequencer (Illumina). Raw sequences are demultiplexed and reads are mapped onto the mm10 reference genome using the v2.3 Cell Ranger pipeline (10X Genomics ...
-
bioRxiv - Cell Biology 2022Quote: ... Image analysis and base calling were performed with the standard pipeline version RTA1.17.21.3 (Illumina).
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were prepared according to the standard protocol recommended by Illumina (Illumina, CA, USA). Index PCR was used to add the unique dual indexes to the sequences ...
-
bioRxiv - Microbiology 2023Quote: ... The detailed experimental procedure was performed according to the standard protocol provided by Illumina, including DNA quality testing ...
-
bioRxiv - Microbiology 2024Quote: ... the library was constructed using a TruSeq standard mRNA LT Sample Prep kit (Illumina), and 100-bp paired-end reads were sequenced using a NovaSeq 6000 system (Illumina) ...
-
bioRxiv - Microbiology 2024Quote: ... where a sequencing library was prepared using a standard Illumina Stranded mRNA kit (Illumina) to generate 150 bp pair-end reads ...
-
bioRxiv - Microbiology 2024Quote: ... Mutant libraries were selected on LB plates containing kanamycin 500 µg/mL and streptomycin 25 µg/mL and pooled genomic DNA fragments were analysed using a MiSeq sequencer (Illumina, San Diego, CA, USA).
-
bioRxiv - Evolutionary Biology 2024Quote: Library preparation and sequencing - DNA from 15 clones was used to prepare PCR-free paired-end sequencing libraries (Illumina DNA Prep PCR free) with an insert size of ∼300bp ...
-
bioRxiv - Microbiology 2024Quote: ... and 0.2 µg/µL of DNA was sequenced by Illumina MiSeq runs (Illumina Inc. ...
-
bioRxiv - Genomics 2023Quote: ... and 0.2 µg/µL of DNA was sequenced by Illumina MiSeq runs (Illumina Inc. ...
-
bioRxiv - Cancer Biology 2021Quote: ... followed by sequencing on the illumine sequencing platform (HiSeqTM 2500, Illumina, Shanghai OE Biotech Co., Ltd.), and 150-bp paired-end reads were generated ...
-
bioRxiv - Plant Biology 2021Quote: ... adding the Illumina adapters (Kapa HiFi Hotstart PCR kit KK502, standard Illumina adapters and cycling). The library was cleaned with.8x volume SPRI beads ...
-
bioRxiv - Genomics 2021Quote: ... RNA libraries were constructed by using a TruSeq standard mRNA HT sample prep kit (Illumina). Library sequencing was performed by an Illumina HiSeq system with a read length of 93 nt ...
-
bioRxiv - Plant Biology 2021Quote: ... according to the manufacturer protocols of the Illumina Standard mRNA-seq library preparation kit (Illumina) using poly A selection ...
-
bioRxiv - Genetics 2020Quote: ... and standard sample preparation protocols and RNA-seq was performed on a Hiseq2000 machine (Illumina) at the NKI Genomics Core Facility ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... cDNA libraries were produced using a TruSeq Standard mRNA Library Prep Kit for NeoPrep (Illumina). Library sequencing was carried out on a Hi-seq4000 (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... Linear RNA was digested following standard protocols using Epicentre Ribonuclease R (Illumina, San Diego, USA). Following purification ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA libraries were prepared according to a standard protocol and sequenced on MiniSeq platform (Illumina) with paired-end 150 cycles (75 + 75) ...
-
bioRxiv - Genomics 2022Quote: ... Both DNA and RNA pair-end followed with standard protocol and were sequenced by Illumina HiSeq 2500 (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... and used for standard poly(A)+ selection and library preparation with the TruSeq kit (Illumina). Following sequencing to at least 20 million reads on a NovaSeq platform (Illumina) ...
-
bioRxiv - Evolutionary Biology 2021Quote: Selected plasmid-free clones were sequenced on MiSeq platform (Illumina) as described below to investigate possible single nucleotide mutations (SNPs ...
-
Genomic bases of insularity and ecological divergence in barn owls (Tyto alba) of the Canary IslandsbioRxiv - Evolutionary Biology 2022Quote: ... and individually tagged 100bp TruSeq DNA PCR-free libraries (Illumina) were prepared according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We used a Truseq DNA PCR-free LT kit (Illumina) for library preparation ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5.4μL nuclease-free water and 2.5μL TDE1 (Tn5 enzyme, Illumina)] followed by incubation at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2022Quote: ... 22 μl of nuclease-free water) (#20034197, Illumina; #G9441, Promega) for incubattion at 37°C with shaking at 300 rpm for 30 min ...
-
bioRxiv - Genomics 2023Quote: ... TruSeq® DNA PCR-Free Sample Preparation Kit (Illumina, USA) was used as per the manufacturer’s protocol for sequencing library preparation ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2500-5000 cells were sequenced at a depth of 50000-100000 reads per cell on a NovaSeq (Illumina). Preprocessing of the data was performed using CellRanger (10x Genomics) ...
-
bioRxiv - Neuroscience 2021Quote: ... The seq library was prepared with a standard TruSeq RNA Sample Prep Kit v2 protocol (Illumina), as described previously (Mariottini et al. ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The second step of PCR used standard Nextera XT Index v2 primers (Illumina #FC-131-2004) to further label samples representing different conditions and timepoints with unique identifiers that allow for multiplexing on the same sequencing lane ...
-
bioRxiv - Microbiology 2024Quote: ... USA) after preparing sequencing libraries using standard paired-end genomic DNA sample prep kit from Illumina. Paired-end sequence data was collected with a read length of 150 bp ...
-
bioRxiv - Neuroscience 2023Quote: ... The sequencing library was prepared with a standard TruSeq RNA Sample Prep Kit v2 protocol (Illumina), as described previously [30 ...
-
bioRxiv - Microbiology 2023Quote: ... Germany) after preparing sequencing libraries using standard paired-end genomic DNA sample prep kit from Illumina. Genome sequences were compared with that of the parent M ...
-
bioRxiv - Genomics 2023Quote: ... Bisulfite converted DNA was then put through the standard Infinium HD array based methylation assay (Illumina) with Illumina Infinium HumanMethylation EPIC BeadChips ...
-
bioRxiv - Genomics 2023Quote: ... variant calls were used in this step from both germline blood sequencing and standard fidelity (Illumina) tumor sequencing to focus the analysis on low-level mosaic calls.
-
bioRxiv - Neuroscience 2023Quote: ... DNA primers TS Primer-X (“X” stands for barcode index; CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCCTTGGCACCCGAG AATTCCA, N=standard Illumina barcodes) and TS Primer-1 (AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATC ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA libraries were prepared using standard Illumina kits and were run using a MiSeq sequencer (Illumina) in a 2x250 paired-end scheme.
-
bioRxiv - Cell Biology 2024Quote: ... Qualifying samples were then prepped following the standard protocol for the Illumina Stranded mRNA prep (Illumina). Sequencing was performed on the Illumina NextSeq2000 with Paired End 59bp × 59bp reads by BRC-sequencing facility ...
-
bioRxiv - Neuroscience 2024Quote: ... Qualifying samples were then prepped following the standard protocol for the Illumina Stranded mRNA prep (Illumina). Sequencing was performed on the Illumina NextSeq2000 with Paired End 59bp × 59bp reads.
-
bioRxiv - Evolutionary Biology 2021Quote: ... Illumina libraries were prepared with IlluminaTruSeq DNA PCR-free kits (Illumina) and sequenced as 150 bp paired-end reads on Illumina HiSeq X Ten by Macrogen Inc ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and prepared individually tagged 100bp “TruSeq DNA PCR-free” libraries (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: TruSeq DNA PCR-free Library Preparation Kit (Illumina, San Diego, CA) was performed following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 19.5µl of nuclease-free water) (FC-121-1030, Illumina; G9441, Promega). Transposition reactions were incubated at 37°C for 30 minutes in an Eppendorf ThermoMixer with agitation at 1000 RPM ...
-
bioRxiv - Cell Biology 2024Quote: ... 22 μl of nuclease-free water) (Illumina, #20034197 and Promega, #G9441) at 37°C for 30 minutes with 300 rpm shaking ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing libraries were prepared using the TruSeq PCR-Free Kit (Illumina) according to manufacturer’s instructions and sequencing was performed on Illumina MiSeq (2 × 250 bases).
-
bioRxiv - Microbiology 2024Quote: ... and libraries prepared with the TruSeq DNA PCR-Free Kit (Illumina) were sequenced in house on the Illumina MiSeq (2 × 250-base reads).
-
bioRxiv - Genomics 2024Quote: ... Constructed libraries with Truseq DNA PCR-Free Library Prep Kits (Illumina) were utilized for subsequent steps ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We used a Truseq PCR Free protocol with NovaSeq 6000 (Illumina), 150–base pair (bp ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... or the TruSeq PCR-free DNA kit (Illumina, San Diego, CA). We quantified libraries with a Qubit fluorometer using the 1x HS kit (Thermo Fisher ...