Labshake search
Citations for Illumina :
101 - 150 of 9305 citations for Rat T Cell Surface Glycoprotein CD3 Gamma Chain CD3G ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... and TruSeq Stranded Total RNA Human/Mouse/Rat (Illumina, 20020596) with 100 ng of input and 13 PCR cycles ...
-
bioRxiv - Cell Biology 2021Quote: ... They were then quantified by quantitative polymerase chain reaction (qPCR) and sequenced on a NextSeq500/550 System (Illumina, San Diego, CA, USA) according to the manufacturer instructions ...
-
bioRxiv - Genomics 2020Quote: ... Illumina TruSeq Stranded Total RNA Ribo-Zero Human/Mouse/Rat Gold (Illumina) was used to construct ribosomal RNA depleted sequencing libraries ...
-
bioRxiv - Neuroscience 2022Quote: ... reads were mapped to the Rnor 6.0 rat genome obtained from Illumina iGenomes (Ensembl ...
-
bioRxiv - Immunology 2021Quote: ... and BCR IgG heavy chain loci were performed at Repertoire Genesis Incorporation (Osaka, Japan) using an unbiased amplification method with MiSeq (Illumina, San Diego, CA, USA). Data processing ...
-
bioRxiv - Microbiology 2022Quote: ... The latter was quantified by real-time quantitative reverse transcriptase-polymerase chain reaction and then sequenced on a Illumina MiSeq system with 2 × 250bp paired-end reads (Illumina Inc., San Diego, CA, USA) at the GeT-PlaGe Platform (Toulouse ...
-
bioRxiv - Microbiology 2021Quote: ... All RNA samples were treated with RiboZero (Human/Mouse/Rat) (Illumina, San Diego, CA) for the depletion of ribosomal RNA ...
-
bioRxiv - Genetics 2020Quote: RNA-seq libraries (TruSeq® Stranded Total RNA Library Prep Human/Mouse/Rat, Illumina) were prepared from 150 ng of previously isolated viral RNA according to the manufacturers’ protocol ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were generated with the Chromium Single Cell ATAC Library & Gel Bead Kit (1000111) and sequenced using the NextSeq 500/550 High Output Kit v2.5 (Illumina) on an Illumina NextSeq 550 platform ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was prepared using the manufacturers protocol (Chromium Single Cell 3’ reagent kits kit v3, 10x Genomics) and sequenced on a Novaseq 6000 instrument (Illumina). After sample processing and quality control analysis ...
-
bioRxiv - Molecular Biology 2023Quote: ... The abundance of the guide RNAs in the T = 0 and T10 replicates was determined by Illumina Next Generation Sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... using an Illumina HiSeq Flow Cell v4 and TruSeq SBS Kit v4 (Illumina). Raw sequencing read data was processed using RTA version 1.18.61 and CASAVA 1.8.4 to generate FASTQ-files ...
-
bioRxiv - Developmental Biology 2022Quote: ... ATAC-seq libraries were generated from the cells using the Nextera Kit (Illumina), as previously reported (Buenrostro et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the NovaSeq 6000 SBS v1 Kit and an S4 flow cell (Illumina).
-
bioRxiv - Molecular Biology 2023Quote: ... Hamilton using a NovaSeq SP flow cell with the 500 cycle kit (Illumina) and 5% PhiX spike in ...
-
bioRxiv - Cancer Biology 2019Quote: ... Single cell library preparation was performed using a Chromium Single Cell 3’ Reagent Kit v3 (10X Genomics) and sequenced by Illumina HiSeq ...
-
bioRxiv - Cancer Biology 2021Quote: ... for single-cell RNA sequencing (with the 10X Genomics single-cell gene expression kit, a 400M read flow cell & single-end read using HiSeq from Illumina). 2,453 cells were sequenced with an average of 64,404 reads (and 3,457 genes ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: ... RNA-sequencing libraries were then prepared from RNA isolated from the bulk mutant AML bone marrow cells and the normal CD34+ bone marrow cells using TruSeq Stranded Total RNA kit (Illumina) described above ...
-
bioRxiv - Immunology 2022Quote: Samples were prepared using a Chromium Single Cell 3’ Reagent Kit (10x Genomics) and run on a NovaSeq S4-200 cell (Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... For mouse and rat sequencing data the reference genome GRCm38 and Rnor 6.0 provided by Illumina igenomes were used ...
-
bioRxiv - Developmental Biology 2022Quote: ... libraries were constructed with Single Cell 3ʹ Reagent Kits v2 before sequencing by Illumina Novaseq.
-
bioRxiv - Immunology 2019Quote: Single-cell RNA-sequencing libraries were generated using the 10x Genomics Single Cell 3’ Solution (version 2) kit and sequenced to an average depth of > 200k reads/cell (Illumina HiSeq 4000). Data analysis was performed using Python3 pipelines (https://github.com/sansomlab/tenx ...
-
bioRxiv - Genomics 2021Quote: ... Bulk cell line libraries were sequenced on the NextSeq using the Mid-Output kit (Illumina). Cord blood ...
-
bioRxiv - Neuroscience 2023Quote: ... and converted to cDNA (NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina). cDNA from each sample was amplified and barcoded in a mild stringency PCR (20 cycles of 30 seconds at 98°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples that met the Illumina TruSeq Stranded Total RNA (Human/Mouse/Rat) (Illumina Inc., San Diego, CA,USA) sample input guidelines were prepared according to the kits protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... Approximately 1 ng of cDNA per cell was transformed into a single-cell library using the Nextera XT DNA Library prep kit (Illumina FC-131-1096) and following the manufacturer’s instructions with slight modifications ...
-
bioRxiv - Molecular Biology 2021Quote: ... using a Truseq-P5 hybrid constant oligo (IDT, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC T) and Nextera N7XX indexing primer (Illumina, Inc., FC-131-1001). Final libraries (4nM ...
-
bioRxiv - Molecular Biology 2019Quote: ... or conventional short read RNA-seq of fragmented cDNAs at 20 million (T) or 100 million (N) read depth (Illumina). Full length RNA-seq data were processed using the ToFU platform ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RNA integrity was evaluated using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA 95051 USA. mRNA was isolated using poly T beads, whereafter Illumina libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit ...
-
bioRxiv - Genetics 2024Quote: ... we aligned the corresponding short reads to the human reference GRCh38 using bwa mem23 (v 0.7.17-r1188; -t 48 -R “@RG\tID:1\tLB:lib1\tPL:ILLUMINA\tSM:
\tPU:unit1”). Next ... -
bioRxiv - Microbiology 2024Quote: ... Raw genomic reads obtained by Illumina HiSeq 2500 and NovaSeq 6000 (for D. grisea, E. coxiae, Galdieria sp. ACUF 613, M. erythrocladioides, P. aerugineum, and T. oligopyrenoides) and by Illumina HiSeq 2500 and NovaSeq 6000 plus Oxford Nanopore MinION Mk 1B (for R ...
-
bioRxiv - Developmental Biology 2021Quote: RNA from sorted human and naked mole-rat populations was sequenced at ∼100 million reads on a HiSeq2500v4 (Illumina), the SMARTer® Ultra® Low RNA Kit (Takara ...
-
Naked Mole-Rat Hematopoietic Stem and Progenitors are Highly Quiescent with an Inherent Myeloid BiasbioRxiv - Cell Biology 2021Quote: RNA from sorted human and naked mole-rat populations was sequenced at ∼100 million reads on a HiSeq2500v4 (Illumina), the SMARTer® Ultra® Low RNA Kit (Takara ...
-
Evolutionarily divergent mTOR remodels the translatome to drive rapid wound closure and regenerationbioRxiv - Developmental Biology 2021Quote: ... The libraries were prepared by the Stanford Genomic Services Center per manufacturer’s instructions using the TruSeq Stranded Total RNA Library Prep with Ribo-Zero Gold Human/Mouse/Rat (Illumina) and sequenced (PEx150 ...
-
bioRxiv - Genomics 2020Quote: ... Lysed cells were then transposed using the Nextera DNA library prep kit (Illumina #FC-121-1030) for 30 min at 37C ...
-
bioRxiv - Microbiology 2021Quote: Clusters were generated on a flow cell within a cBot using the Cluster Generation Kit (Illumina). Libraries were sequenced as 50 bp-reads on a HiSeq 2500 using the sequence by synthesis technique (Illumina) ...
-
bioRxiv - Systems Biology 2022Quote: ... high-throughput RNA sequencing was performed with NovaSeq 6000 S4 reagent kit and flow cell (Illumina). Sequence read files were quality assessed and trimmed with FastQC v0.11.9 [25] and Trimmomatic v0.39 [26] ...
-
bioRxiv - Molecular Biology 2022Quote: The LSK cell samples obtained by sorting were processed with the DNA Library Prep Kit (Illumina). The tagged DNA was purified with the DNA Clean ConcentratorTM5 Kit (Zymo Research) ...
-
bioRxiv - Microbiology 2021Quote: ... before loading on the flow cell of the 500 cycle MiSeq Reagent Kit v2 (Illumina, USA) and pair-end sequencing (2 × 250 bp) ...
-
bioRxiv - Microbiology 2022Quote: ... 100,000 cells were used to for transposition reaction (Illumina Tagment DNA TDE1 Enzyme and Buffer Kit). Tagmented DNA was purified with MinElute purification kit (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... Equimolarly pooled libraries were sequenced on a MiSeq Reagent Kit v2 (300 cycles) flow cell (Illumina) with 2 x 150 bp read length ...
-
bioRxiv - Microbiology 2023Quote: ... the flow cell was loaded onto HiSeq 2500 for sequencing using HiSeq SBS kit v4 (Illumina). DNA was sequenced from both ends (paired-end ...
-
bioRxiv - Microbiology 2023Quote: ... was applied with S2 flow cells and the 2 x 150 bp paired-end kit (Illumina) according to company protocols ...
-
bioRxiv - Developmental Biology 2024Quote: ... Single-cell RNA-seq libraries were prepared using a Nextera XT DNA Library Preparation Kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: Directional libraries were constructed using NEBNext Single Cell/Low Input RNA Library Prep Kits from Illumina following manufacturer instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... the flow cell was loaded onto HiSeq 2500 for sequencing using HiSeq SBS kit v4 (Illumina). DNA was sequenced from both ends (paired-end ...
-
bioRxiv - Immunology 2021Quote: ... Libraries were prepared following 10X Genomics protocols (Chromium Single Cell 3’ Reagent Kits v2 Chemistry) and sequenced on NovaSeq 6000 (Illumina S2 flow cell, paired-end). FASTQ files were processed using cellranger (https://support.10xgenomics.com/single-cell-gene-expression/software/pipelines/latest/what-is-cell-ranger ...
-
The RNA-Binding Protein SAM68 regulates cardiomyocyte differentiation by enhancing Gata4 translationbioRxiv - Molecular Biology 2022Quote: ... rRNA depletion and library preparation was done with the TruSeq stranded total RNA Library prer Human/Mouse/Rat (20020596, Illumina). The sequencing was performed using 2×125bp paired-ends reads on a HiSeq 2500 sequencer with HiSeq v4 chemistry ...
-
bioRxiv - Cancer Biology 2022Quote: ... Libraries were generated from 1 μg of total RNA using a TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat (48 Samples) (Illumina) per manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... rRNA was removed and total RNA library was prepared with TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat (Illumina) and sequenced by Illumina platform HiSeq2500 Paired-end 125 bp.