Labshake search
Citations for Illumina :
101 - 150 of 8956 citations for Mouse Histone H3.3C H3 5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... Ribosomal RNA (rRNA) was then depleted from each sample (5 µg each) using the bacterial Ribo-Zero rRNA Removal Kit (Illumina). The integrity of the RNA was evaluated using an RNA 6000 Nano LabChip and an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Immunology 2020Quote: ... 0.3 to 0.5 ng of pre-amplified cDNA was used to generate barcoded Illumina sequencing libraries (Nextera XT library preparation kit, Illumina) in an 8μL reaction volume ...
-
bioRxiv - Genomics 2021Quote: ... The 20 ul preamp was then mixed with 25 ul TD buffer and 5 ul TDE1 buffer (Nextera kit, FC-131-1096, Illumina) and incubated for 5 min at 55 C and held at 10 C ...
-
bioRxiv - Microbiology 2022Quote: ... Ribosomal RNA (rRNA) was subsequently depleted from each RNA sample (5 µg each) using the bacterial Ribo-Zero rRNA Removal Kit (Illumina). The integrity of the RNA was evaluated using an RNA 6000 Nano LabChip and an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... A 2.5 kb jumping library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced at the Broad Institute Genomics Platform on an Illumina HiSeq 2000 system to generate paired 101-base reads ...
-
bioRxiv - Microbiology 2023Quote: ... 3-5 µg of each sample was treated with Ribozero® rRNA Removal Kit according to the manufacturer’s instructions (Illumina, USA ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA was dephosphorylated in 3’ and then phosphorylated in 5’ to generate cDNA libraries using the NebNext Small RNA Sample Prep kit with 3’ sRNA Adapter (Illumina) according to the manufacturer’s protocol with 12 cycles of PCR amplification in the last step followed by DNA purification with Monarch PCR DNA cleanup kit (NEB) ...
-
bioRxiv - Genomics 2022Quote: Small RNA libraries were prepared starting from 5 µL RNA eluate using the TruSeq Small RNA Library Prep Kit (Illumina, RS-200-0012 ...
-
bioRxiv - Cancer Biology 2023Quote: RNA-seq libraries were prepared with 0,5-1 µg of total high quality RNA collected from samples and the Illumina Stranded Total RNA Prep kit (Illumina) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Illumina sequencing libraries were indexed with unique 5’ and 3’ barcode combinations (up to 384 cells) using the Nextera XT DNA library preparation kit (Illumina). Libraries were pooled and size-selected with 0.9X AmpPure XP beads ...
-
bioRxiv - Genomics 2024Quote: ... A 2.5-kb ‘jumping’ library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced on an Illumina HiSeq 2000 ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA libraries were constructed from individual mouse samples and RNA-seq libraries were constructed using the Nextera XT DNA Library Preparation Kit (Illumina). Libraries were sequenced on the Illumina platform ...
-
bioRxiv - Developmental Biology 2020Quote: ... Ribosomal RNA was removed from 500ng of input RNA using either Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) from Illumina or NEBNext rRNA Depletion Kit (Human/ Mouse/ Rat) ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA-Seq libraries were made following a standard protocol using Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) and TruSeq Stranded mRNA Library Prep (Illumina) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Sequencing libraries were generated using the TruSeq Stranded Total RNA with Ribo-Zero Human/ Mouse/Rat Low-throughput (LT) kit (Illumina) and run on a NextSeq 500 for paired-end sequencing using the NextSeq 500/550 High Output v2 Kit ...
-
bioRxiv - Genomics 2020Quote: Illumina sequencing libraries of total RNA were prepared using the Illumina TruSeq Stranded Total RNA Human/Mouse/Rat kit (Cat number RS-122-2201) following the protocol provided by Illumina with Ribo-Zero.
-
bioRxiv - Systems Biology 2019Quote: ... was measured using an Agilent Bioanalyzer and samples were ribo-depleted using a using a RiboZero Gold (Human/Mouse/Rat) kit (Illumina) to remove rRNAs ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of input RNA was used for rRNA removal with Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat) (Illumina). Libraries were generated with the NEBNext Ultra Directional RNA Library Prep kit for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... Libraries were prepared from 1 μg of total RNA using a TruSeq Stranded Total RNA Kit with Ribo-Zero Human/Mouse/Rat (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... The eluted RNAs were ribodepleted by using the rRNA removal section of a TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat kit (Illumina), with the supernatant from the magnetic-bead separation cleaned-up by using a Zymo RNA Clean & Concentrator kit with 8X ethanol ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA-seq libraries were prepared using the TruSeq Stranded Total RNA LT Sample Prep Kit with Ribo-Zero Human/Mouse/Rat (Illumina). We generated biological triplicate data for 1T47 ...
-
bioRxiv - Genomics 2019Quote: ... cDNA libraries were constructed using Illumina TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Human/Mouse/Rat Set B (Illumina) to deplete ribosomal RNA according to the manufacturer’s instruction ...
-
bioRxiv - Genomics 2019Quote: ... The Agilent 2100 Bioanalyzer was used to assess RNA quality and only high quality RNA (RIN > 8) was further processed for removal of ribosomal RNA with the Ribo-Zero Magnetic Gold Kit (Human/Mouse/Rat; Illumina). Ribosomal-depleted RNA was used as input for library preparation with Illumina TruSeq V2 RNA prep kit and processed according to the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 ug of total RNA were processed for rRNA depletion by Ribozero Gold rRNA Removal kit (Human/Mouse/Rat) (Illumina) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μg chromatin-associated RNAs were depleted of ribosomal RNA depletion using Ribo-Zero Magnetic Gold Kit (human/mouse/rat; Illumina), according to the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μg chromatin-associated RNAs were depleted of ribosomal RNA depletion using Ribo-Zero Magnetic Gold Kit (human/mouse/rat; Illumina), according to the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2021Quote: ... rRNA was depleted using Ribo-Zero™ Magnetic Gold Kit for rRNA depletion (Human/Mouse/Rat) (Epicentre for Illumina #MRZG12324) according to manufacturer’s guidelines ...
-
bioRxiv - Genomics 2020Quote: RNA from a subset of human fetal (n = 3) and mouse (n = 8) cortex tissue samples was prepared with TruSeq Stranded mRNA Sample Prep Kit (Illumina) and subjected to 125bp paired-end sequencing using a HiSeq2500 (Illumina) ...
-
bioRxiv - Microbiology 2020Quote: ... ribosomal RNA (rRNA) was depleted from the total RNA extracts using the Ribo-Zero Gold (human-mouse-rat) kit (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sequencing libraries were generated using the TruSeq Stranded Total RNA with Ribo-Zero Human/ Mouse/Rat Low-throughput (LT) kit (Illumina) and run on a NextSeq 500 for paired-end sequencing using the NextSeq 500/550 High Output v2 Kit ...
-
bioRxiv - Neuroscience 2022Quote: ... Both samples (footprints and total mRNA) went through a ribosomal RNA removal step using the Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina). The footprint samples were then purified on a 15% TBE-Urea polyacrylamide gel (ThermoFisher Scientific ...
-
bioRxiv - Physiology 2022Quote: ... one microgram of total RNA was used to construct cDNA libraries with the TruSeq Stranded Total RNA with Ribo-Zero Gold Human/Mouse/Rat kit (Illumina). Sequencing was performed using Illumina NovaSeq 6000 (coverage - 50 x ...
-
bioRxiv - Molecular Biology 2022Quote: ... rRNA was depleted from total RNA using the Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat) (Illumina, San Diego, CA) to enrich for coding RNA and long non-coding RNA ...
-
bioRxiv - Microbiology 2023Quote: ... Ribosomal RNA was depleted using the RiboZero rRNA Removal Kits for Gram-positive bacteria and/or for human/mouse/rat (Illumina). 300 bp-insert RNA-seq Illumina libraries were constructed using ∼1.0 μg of enriched mRNA that was fragmented then used for synthesis of strand-specific cDNA using the NEBnext Ultra Directional RNA Library Prep Kit (NEB-E7420L) ...
-
bioRxiv - Genomics 2023Quote: ... 1 µg RNA was converted to ribosomal depleted cDNA libraries ready for sequencing using the TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... rRNA was depleted from total RNA using the Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat) (Illumina, San Diego, CA) to enrich for coding RNA and long non-coding RNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was extracted with a Direct-zol RNA MicroPrep Kit and subjected to an RNA-Seq library preparation using a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) followed by a TruSeq Stranded Total RNA Kit (Illumina) ...
-
bioRxiv - Microbiology 2024Quote: ... total RNA from mouse gut or human donors was subjected to ribosomal RNA depletion by Ribo-Zero Plus Microbiome rRNA Depletion Kit (Illumina) and cDNA libraries were generated by using Illumina Stranded Total RNA Prep (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... 1.5 ng cDNA was tagmented using 0.5 μl TruePrep Tagment Enzyme V50 and 1x TruePrep Tagment Buffer L (TruePrep DNA Library Prep Kit V2 for Illumina, Vazyme), followed by an incubation step at 55 °C for 10 min ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) were sequenced using the Illumina MiSeq 2 × 300 bp platform with MiSeq Reagent Kit v3 (Illumina Co.) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Purified PCR products were given unique dual indexes at the 5’ end using the Nextera XT Index Kit v2 index primers (Illumina, USA). To attach the index primers ...
-
bioRxiv - Immunology 2020Quote: ... Supernatant was discarded and nuclei were re-suspended in 50 μl reaction buffer containing 5.0 μl Tn5 transposase and 10 μl of 5 × TTBL buffer (TruePrepTM DNA Library Prep Kit V2 for Illumina, Vazyme Biotech). The reaction was incubated at 37°C for 30 min ...
-
bioRxiv - Genomics 2021Quote: ... Samples were concentrated using a centrifugal evaporator Speed Vac® to a final volume of 5 μl and we started the TruSeq Small RNA Sample Preparation Kit (Illumina) protocol according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: Sequencing libraries were prepared from 100 ng DNA using the TruSeq Nano DNA sample preparation kit (cat# 20015964/5, Illumina Inc.) targeting an insert size of 350bp ...
-
bioRxiv - Cancer Biology 2020Quote: ... Extracted nuclei was processed for TN-5 mediated tagmentation using the Illumina Tagment DNA Enzyme and buffer kit (Nextera Illumina # 20034210) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Ribosomal RNAs were depleted from 5 μg of total RNA of the sample by Ribo-Zero rRNA Removal Kit (Seed, Root) (Illumina®). After rRNA depletion ...