Labshake search
Citations for Illumina :
101 - 150 of 8868 citations for Human Guanylate Binding Protein 6 GBP6 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μg chromatin-associated RNAs were depleted of ribosomal RNA depletion using Ribo-Zero Magnetic Gold Kit (human/mouse/rat; Illumina), according to the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μg chromatin-associated RNAs were depleted of ribosomal RNA depletion using Ribo-Zero Magnetic Gold Kit (human/mouse/rat; Illumina), according to the manufacturer’s instruction ...
-
bioRxiv - Immunology 2021Quote: ... Sequencing was performed in the Human Immunology Core Facility at the University of Pennsylvania using an Illumina 2× 300-bp paired-end kit (Illumina MiSeq Reagent Kit v3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... rRNA was depleted using Ribo-Zero™ Magnetic Gold Kit for rRNA depletion (Human/Mouse/Rat) (Epicentre for Illumina #MRZG12324) according to manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2020Quote: ... ribosomal RNA (rRNA) was depleted from the total RNA extracts using the Ribo-Zero Gold (human-mouse-rat) kit (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sequencing libraries were generated using the TruSeq Stranded Total RNA with Ribo-Zero Human/ Mouse/Rat Low-throughput (LT) kit (Illumina) and run on a NextSeq 500 for paired-end sequencing using the NextSeq 500/550 High Output v2 Kit ...
-
bioRxiv - Neuroscience 2022Quote: ... Both samples (footprints and total mRNA) went through a ribosomal RNA removal step using the Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina). The footprint samples were then purified on a 15% TBE-Urea polyacrylamide gel (ThermoFisher Scientific ...
-
bioRxiv - Physiology 2022Quote: ... one microgram of total RNA was used to construct cDNA libraries with the TruSeq Stranded Total RNA with Ribo-Zero Gold Human/Mouse/Rat kit (Illumina). Sequencing was performed using Illumina NovaSeq 6000 (coverage - 50 x ...
-
bioRxiv - Molecular Biology 2022Quote: ... rRNA was depleted from total RNA using the Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat) (Illumina, San Diego, CA) to enrich for coding RNA and long non-coding RNA ...
-
bioRxiv - Microbiology 2023Quote: ... Ribosomal RNA was depleted using the RiboZero rRNA Removal Kits for Gram-positive bacteria and/or for human/mouse/rat (Illumina). 300 bp-insert RNA-seq Illumina libraries were constructed using ∼1.0 μg of enriched mRNA that was fragmented then used for synthesis of strand-specific cDNA using the NEBnext Ultra Directional RNA Library Prep Kit (NEB-E7420L) ...
-
bioRxiv - Genomics 2023Quote: ... 1 µg RNA was converted to ribosomal depleted cDNA libraries ready for sequencing using the TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... rRNA was depleted from total RNA using the Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat) (Illumina, San Diego, CA) to enrich for coding RNA and long non-coding RNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was extracted with a Direct-zol RNA MicroPrep Kit and subjected to an RNA-Seq library preparation using a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) followed by a TruSeq Stranded Total RNA Kit (Illumina) ...
-
bioRxiv - Microbiology 2024Quote: ... total RNA from mouse gut or human donors was subjected to ribosomal RNA depletion by Ribo-Zero Plus Microbiome rRNA Depletion Kit (Illumina) and cDNA libraries were generated by using Illumina Stranded Total RNA Prep (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... The prepared library was sequenced using a MiSeq sequencing system with a V3 reagent kit (300 × 2 bp; Illumina, 4–6 samples). Lake Biwa viral contigs/genomes (LBVs ...
-
bioRxiv - Cancer Biology 2020Quote: ... and hybridized to BeadChip Array MouseWG-6 (Illumina). Bead chips were scanned with an Illumina BeadArray Reader ...
-
bioRxiv - Systems Biology 2024Quote: ... and hybridized on mouseWG-6 v2 BeadArrays (Illumina). Slides were scanned using an iScan (Illumina SY-101- 1001 ...
-
bioRxiv - Genomics 2021Quote: ... platform = c(”Illumina Human Methylation 450”), and sample.type = c(”Primary solid Tumor”,”Solid Tissue Normal”) ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA-seq libraries were generated using Illumina SureCell WTA 3’ Library Prep Kit for the ddSEQ System (6 cartridge version, cat.no. 20014280, Illumina, San Diego, CA, USA). Libraries were assessed for quality ...
-
bioRxiv - Microbiology 2021Quote: ... The library was loaded at 6 pM and sequenced using the Miseq Reagent Kit v3 (600-cycle) (Illumina; catalog no., MS-102-3003).
-
bioRxiv - Plant Biology 2020Quote: ... Genomic DNA from infected barley leaves at 6 days post-inoculation (dpi) was isolated by using the MasterPure™ Complete DNA&RNA purification Kit (Epicentre®, Illumina®) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The library was loaded at 6 pM and sequenced using the Miseq Reagent Kit v3 (600-cycle) (Illumina; catalog no., MS-102-3003).
-
bioRxiv - Cancer Biology 2023Quote: ... Illumina sequencing libraries with 6-bp single indices were constructed from 1 μg total RNA using the TruSeq Stranded mRNA LT kit (Illumina, RS-122-2101). The resulting library was validated using the Standard Sensitivity NGS Fragment Analysis Kit (AATI ...
-
bioRxiv - Molecular Biology 2020Quote: Ribosomal RNA was depleted from the total RNA using the Ribo-Zero Gold rRNA removal kit (Human/Mouse/Rat) (Illumina, USA). The ribo-depleted RNA was used to create an ssRNA-Seq library ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNA-Seq libraries were prepared using TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Human (RS-122-2201, Illumina Inc.) following manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... The remaining 1μl re-dissolved contents were tagmented using 0.6 μl TD Tagmentation buffer and 0.3 μl ATM Tagmentation enzyme from Nextera XT DNA Library Prep Kit (Illumina, catalog no. FC-121-1030) for 5min at 55 °C ...
-
bioRxiv - Genomics 2021Quote: ... four human CNV membranes and four human RPE-choroidal control tissues) were sequenced on the NextSeq 500 (Illumina) with 1 × 75 bp ...
-
bioRxiv - Neuroscience 2020Quote: ... and hybridized to MouseWG-6 v2.0 Expression BeadChips (Illumina). Raw data were preprocessed with quantile normalization in R/Bioconductor using the package beadarray ...
-
bioRxiv - Microbiology 2024Quote: The Illumina TruSeq Stranded Total RNA Sample Prep Kit with Ribo-Zero Human/Mouse/Rat protocol (Illumina, Inc. San Diego, CA, USA) was used for the following steps ...
-
bioRxiv - Genomics 2021Quote: BD Infinium Human Methylation 450 arrays (Illumina) were retrieved from the European Genome-phenome Archive (EGA ...
-
bioRxiv - Neuroscience 2022Quote: ... A Human OmniExpress v1.2 BeadChip array (Illumina) was used post-editing to check for any gross karyotype abnormalities ...
-
bioRxiv - Genomics 2020Quote: ... Each pool (2nM per library; Agilent SureSelect XT HS, n=6; Agilent SureSelect XT RNA Direct, n=6; Illumina TruSeq RNA Exome, n=5) was sequenced on one lane on the Illumina HiSeq 3000 platform in the Technology Center for Genomics and Bioinformatics at UCLA ...
-
bioRxiv - Genetics 2020Quote: ... and the libraries were sequenced in pools of 6 (Illumina HiSeq2500 high output flow-cell ...
-
bioRxiv - Systems Biology 2023Quote: ... a 20 bp placeholder barcode sequence (GGCACTGTAGTCGATAGCCT; bait barcode) and an SP1 Illumina primer binding site (Illumina, San Diego, CA) was cloned in pRS41643 digested with KpnI-HF (New England Biolabs ...
-
bioRxiv - Immunology 2024Quote: ... Gene expression and surface protein libraries were generated using the Chromium Next GEM Single Cell 3 ’Reagent Kits v3.1 and sequenced by Illumina MiSeq or NextSeq2000 ...
-
bioRxiv - Cancer Biology 2019Quote: DNA methylation data (Illumina human methylation 450k BeadChip) and clinical information of 8,118 patients across 24 tissue types were obtained from in GDC data portal [29] using TCGAbiolink (Bioconductor package ...
-
bioRxiv - Genetics 2024Quote: The Infinium Human Methylation EPIC BeadChip (Illumina, USA) array was performed according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Methylation data (Illumina Human Methylation 450 platform) for TCGA cohorts were downloaded from the Firebrowse website hosed by Broad Institute of MIT and Harvard ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Construction of DNA libraries was performed by the Michigan Department of Health and Human Services using the Nextera XT library prep kit (Illumina, San Diego, CA, USA) followed by sequencing on the MiSeq (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... second BsmBI site (producing cut-edge between the base pairing region and dCas9 handle binding region) and read2 (Illumina sequencing element) was amplified from pPEPZ-sgRNAclone (Addgene# 141090 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Index i7 (6 pb barcode) was read with primer HP8 (Illumina).
-
bioRxiv - Evolutionary Biology 2023Quote: ... 6-digit index primers (Illumina RNA PCR Index Primers RPI1-RPI28) were used instead of 10-digit index primers suggested by the LM-Seq protocol ...
-
bioRxiv - Genomics 2020Quote: ... Human libraries were sequenced on a NovaSeq 6000 (Illumina) and mouse libraries on a NextSeq 500 (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA expression log intensity levels (Illumina Human v3 microarray) were used as the expression levels of the genes ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and g2997a) at the forward primer binding site used in the ‘round 1 PCR’ step below (the step attaching partial Illumina sequencing adaptors), thus excluding PCR amplification of the competitor viruses during sequencing library preparation such that only the library viruses ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Extracted DNA was PCR amplified with a forward primer binding to the end of the leader sequence (PCR1 Fwd primer with Illumina adapter overhang) and a reverse primer annealing to the intronic region directly 3’ of the J segment (PCR1 Rev primer with Illumina adapter overhang) ...
-
bioRxiv - Genetics 2021Quote: ... These 6 cats were sequenced on a HiSeq2500 (Illumina, San Diego, CA) to generate 100bp paired-end reads ...
-
bioRxiv - Neuroscience 2019Quote: ... and sequenced 6 samples per lane on a HiSeq 2000 sequencer (Illumina) giving a depth of 30-35 million reads per sample.
-
bioRxiv - Immunology 2020Quote: ... Libraries were sequenced at 101×6×0×101 on a HiSeq (Illumina) to a minimum depth of 30 million reads per sample.
-
bioRxiv - Immunology 2021Quote: ... and mixed with 6 μl of Illumina TDE1 Tn5 transposase (Illumina, 15027916). Transposition was performed by incubating the prepared reactions on a C1000 Touch thermal cycler with 96– Deep Well Reaction Module (Bio-Rad ...