Labshake search
Citations for Illumina :
101 - 150 of 9402 citations for Allopregnanolone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... The subsequent steps of library preparation were all carried out on the Agilent NGS Bravo workstation in 96-well plates following the instructions for the Illumina TruSeq Stranded mRNA kit (Illumina Cat no: 20020595, Illumina, USA). mRNA was purified from 300-800 ng of total RNA through selective-binding on poly dT-coated beads ...
-
bioRxiv - Developmental Biology 2024Quote: ... and TruSeq RNA CD Index Plate (Illumina, USA) for sample multiplexing ...
-
bioRxiv - Genomics 2019Quote: ... the nuclei pellets were resuspended in transposase Master Mix (1.25 μl 10x TD buffer, 5 μl H2O and 6.5 μl of Tn5: Illumina Nextera Kit; FC-121-1031) and incubated for 30 minutes at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... indexing and amplification of the transposed DNA samples was performed by combining 10 µL of transposed DNA with the following: 5 µL of the Nextera i5 and i7 indexed amplification primers (Nextera Index Kit, Illumina, FC-121-1011), 25 μl of the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 TLX1/TLX3 and 5 HOXA) was performed using the TruSeq Stranded Total RNA (w/RiboZero Gold) sample prep kit (Illumina, RS-122-2301), involving depletion of ribosomal (rRNA ...
-
bioRxiv - Genomics 2021Quote: ... RNA-seq libraries were prepared from 500 ng total RNA using the TruSeq stranded mRNA library preparation kit (Illumina Inc, Cat# 20020594/5) including polyA selection ...
-
bioRxiv - Immunology 2020Quote: ... PCR amplification and index incorporation were performed in a 50 μl reaction containing 5 μl of forward and reverse index primers (Illumina Nextera Index Kit), 15 μl NPM ...
-
bioRxiv - Genomics 2020Quote: ... Individual cells were sequenced to a mean depth of ~1.5 million 38 bp paired-end reads on an Illumina NextSeq 500 instrument with 75 cycle high output kits (Illumina TG-160-2005).
-
bioRxiv - Microbiology 2024Quote: Total RNA of 5 μg was used to construct strand-specific RNA-sequencing libraries using the TruSeq RNA sample preparation Kit from Illumina (San Diego, CA). Briefly ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... DNA solutions of approximately ≥5 ng μL−1 were subjected to the tagmentation reaction using the Nextera DNA Flex Library Prep Kit (Illumina, San Diego, CA) was used at 1/40 scale of the provided protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... library was generated for 10 plasma exosome samples (n=5, young and old individuals each) using a propriety Illumina Truseq™ Small RNA Preparation kit (Illumina, # RS-930), according to the manufacturers’ guide ...
-
bioRxiv - Genetics 2022Quote: ... The flow cell was loaded with 5 picomolar pooled libraries containing 5% PhiX control V3 (Illumina). Raw sequencing data were demultiplexed with Bcl2Fastq software (v2.19 ...
-
bioRxiv - Cancer Biology 2019Quote: ... To this end shotgun libraries were generated from 5-10ng of plasma DNA using the TruSeq DNA Nano Sample Preparation Kit (Illumina, San Diego, CA, USA) as previously described[35] ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we added four mate pair libraries (3 kb, 5 kb, 7 kb, 8 kb) prepared using a Nextera Mate Pair Library Prep kit (Illumina, San Diego, CA, USA). Each library was sequenced on an Illumina HiSeq 2500 sequencer by Novogene (Sacramento ...
-
bioRxiv - Genomics 2019Quote: ... A mate pair library with an insert size of 5 kb was created with the Nextera Mate Pair Sample Prep Kit (Illumina, San Diego, CA, USA). The paired-end and mate pair libraries were sequenced on an Illumina MiSeq machine ...
-
bioRxiv - Genomics 2020Quote: Small RNA libraries were prepared starting from 5 µL DNase treated and spike-in supplemented RNA eluate using a TruSeq Small RNA Library Prep Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol with two minor modifications(1) ...
-
bioRxiv - Immunology 2021Quote: ... The V(D)J enriched library was then constructed via Chromium Single Cell 5’ Library Construction Kit (10x Genomics Cat#1000020) and libraries were sequenced in a NovaSeq™ 6000 Sequencing System (Illumina, San Diego, CA). V(D)J sequences were collapsed using Cell Ranger ...
-
bioRxiv - Cancer Biology 2021Quote: ... Each well contained 10 μL tagmentation buffer (5 μL NIB and 5 μL TD buffer from Illumina). For the second sort plate ...
-
bioRxiv - Genomics 2020Quote: ... using the 96-well plate Nextera indexing primers (Illumina), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... using either single or dual index plates (Illumina 20028313), with a 1% PhiX control library spiked in ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Approximately 5 ug of total RNAs were used to construct cDNA libraries (NEBNext Ultra Directional RNA Library Prep Kit for Illumina, Illumina, San Diego, CA, USA). Transcriptome sequencing was performed using the Illumina Hi-Seq 2000 platform ...
-
bioRxiv - Neuroscience 2022Quote: Total RNAs from cultured mouse WT and CD38 KO astrocytes at 5 DIV were used for RNA library preparation using TruSeq Stranded mRNA Sample Preparation Kit (Illumina, Inc., San Diego, CA, USA), with polyA selection for ribosomal RNA depletion.
-
bioRxiv - Biophysics 2021Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl Nextera i5 primer (S5xx, Illumina), and 5 μl of a custom i7 primer mix (0.5 μM i7_BCx + 10 μM i7_primer ...
-
bioRxiv - Biophysics 2022Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Biophysics 2023Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples (GJJ_1J) ...
-
bioRxiv - Genetics 2020Quote: ... Plates were multiplexed and sequenced on the MiSeq platform (Illumina) using 250 bp paired-end reads (Nano kit ...
-
bioRxiv - Immunology 2022Quote: ... PCR amplification was performed in a 48 well plate (Illumina) on an Eco machine (Illumina) ...
-
bioRxiv - Genomics 2022Quote: ... Full-length adapters (IDT TruSeQ UDI plate, Illumina, cat# 20023784) were used for adapter ligation ...
-
bioRxiv - Cancer Biology 2024Quote: ... and TruSeq RNA CD Index Plate (Illumina Inc. Cat. # 20019792). Reads were trimmed for Illumina universal adapter using cutadapt ...
-
bioRxiv - Cancer Biology 2024Quote: ... and TruSeq RNA CD Index Plate (Illumina Inc. Cat. # 20019792). Reads were trimmed for Illumina universal adapter using cutadapt ...
-
bioRxiv - Systems Biology 2020Quote: ... Supernatants were discarded and nuclei were re-suspended in 50 μl reaction buffer (2.5 μl of Tn5 transposase and 25 μl of TD buffer from a Nextera DNA Library Prep Kit from Illumina, and 22.5 μl nuclease-free H2O). The reaction was incubated at 37°C for 30 min ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Microbiology 2019Quote: ... which was denatured and run on the MiSeq sequencer at a final concentration of 5 pM alongside a 5 pM PhiX control (Illumina). Raw reads generated by MiSeq were error-corrected and filtered using DADA2 through QIIME2 (https://qiime2.org).38 Filtered reads were clustered de novo into Operational Taxonomic Units (OTUs ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2024Quote: ... 16S rRNA PCR amplification and next-generation sequencing were performed at MR DNA (www.mrdnalab.com) using primers 515F-Y (5’-GTGCCAGCMGCCGCGGTAA-3’)73 and 806R (5’-GGACTACHVGGTWTCTAAT-3’)74 using Illumina MiSeq (Illumina Corp) 2x300 paired- end reads ...
-
bioRxiv - Microbiology 2021Quote: ... with 5% (v/v) 20 pM PhiX (Illumina), using 150 cycle v3 cartridges ...
-
bioRxiv - Genomics 2019Quote: ... low call rate (> 5% low quality data [Illumina detection P>1×10−6 ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2023Quote: ... In each sequencing run 5% of PhiX (Illumina) was included as an internal control ...
-
bioRxiv - Cell Biology 2024Quote: ... spiked in with 5% PhiX Control v3 (Illumina) and sequenced on an Illumina Novaseq 6000 at a depth of ∼50,000 reads/cell with dual index ...
-
bioRxiv - Developmental Biology 2024Quote: ... we prepared n=40 sequencing libraries from 1µg total RNA per sample using Illumina® Stranded mRNA Prep kits with unique 5′ and 3′ index adapter pairs (IDT for Illumina® RNA UD Indexes, Set A). Libraries were PCR amplified for 10 cycles ...
-
bioRxiv - Genomics 2024Quote: ... bidentatus DNA extraction and library preparation was performed by Dovetail Genomics (Scotts Valley, CA, USA) with the TruSeq DNA PCR-Free kit (Trueq Index 5, Illumina, San Diego, CA, USA, mean size 475bp). 150 bp paired-end sequencing was performed on one lane of HiSeqX by Novogene (Cambridge ...
-
bioRxiv - Cell Biology 2023Quote: ... after which the plates were sequenced on the NextSeq 500 (Illumina) for 25 million reads per plate.
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Microbiology 2019Quote: 16S amplicon sequencing targeting the V3 and V4 variable regions of the 16S rRNA (341F: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 805R: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) was performed on the Illumina MiSeq platform (Illumina, California, USA) according to manufacturer’s guidelines and generated paired-end reads of 300bp in each direction ...