Labshake search
Citations for Illumina :
101 - 150 of 594 citations for 7 Bromo 5 fluoro 3 methyl 1H indole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... 5 ul TDE1 (Illumina 20034197)) and shaken at 1000 RPM for 30 minutes at 37°C ...
-
bioRxiv - Genomics 2019Quote: ... Bead-bound Hi-C DNA was amplified with 7 PCR amplification cycles using PE PCR 1.0 and PE PCR 2.0 primers (Illumina). After PCR amplification ...
-
bioRxiv - Molecular Biology 2023Quote: ... and each sample was sequenced in 3 different lanes (3 technical replicates per sample) on an Illumina HiSeq platform (Illumina, USA).
-
bioRxiv - Microbiology 2020Quote: ... and sequenced to an average depth of 7 gbp per fraction on the Illumina NovaSeq (Illumina, San Diego, CA).
-
bioRxiv - Microbiology 2021Quote: ... The amplicon library was diluted to 7 pM containing 20 % PhiX before sequencing on the MiSeq platform (Illumina, USA) using MiSeq reagent v3 kit to generate 300 bp paired-end reads ...
-
bioRxiv - Immunology 2020Quote: ... Libraries were sequenced on the iSeq (cases 1 - 6 and controls) or NovaSeq 6000 (case 7 and controls) (Illumina) using 150nt paired-end reads.
-
bioRxiv - Genetics 2022Quote: ... The flow cell was loaded with 5 picomolar pooled libraries containing 5% PhiX control V3 (Illumina). Raw sequencing data were demultiplexed with Bcl2Fastq software (v2.19 ...
-
bioRxiv - Neuroscience 2021Quote: ... using TruSeq SR Cluster Kit 3-cBot-HS (Illumina) and TruSeq SBS Kit 3-HS (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
bioRxiv - Immunology 2024Quote: ... 3 biological replicates were sequenced with NextsSeq 550 (Illumina). For data analysis ...
-
bioRxiv - Developmental Biology 2024Quote: ... library construction was immediately carried out using a Chromium Single Cell 3’ Reagent Kit (Version 3) and sequenced on an Illumina HiSeq 4000 or an Illumina NextSeq2000 (Illumina, cat no. 20040559) by the Technion Medicine Faculty Azrieli-Technion Genomics Center ...
-
bioRxiv - Cancer Biology 2021Quote: ... Each well contained 10 μL tagmentation buffer (5 μL NIB and 5 μL TD buffer from Illumina). For the second sort plate ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Samples with an RNA-integrity number of more than 7 were subjected to library preparation and sequencing to 151 paired-end cycles on the NovaSeq-6000 platform (Illumina), resulting in approximately 35 million reads/sample ...
-
bioRxiv - Plant Biology 2021Quote: ... Samples with a RIN value of > 7 were used for library preparation (Illumina TruSeq Stranded Total RNA kit, Illumina, USA) and sequenced on an Illumina HiSeq 4000 to obtain 150bp paired-end reads ...
-
bioRxiv - Genetics 2022Quote: ... Extracted RNA with RNA integrity number (RIN) ≥7 was used as input for the TruSeq Stranded mRNA HT Sample Prep Kit (Illumina) according to the manufacturer ‘s recommendations ...
-
bioRxiv - Cancer Biology 2019Quote: ... Sequencing was performed on a HiSeq 2000 series for 2 × 100 paired end reads with a 7 nucleotide read for indexes using Cycle Sequencing v3 reagents (Illumina). All regions were covered by >200 reads.
-
bioRxiv - Genomics 2021Quote: ... [140] with parameters “2 7 7 80 10 100 2000 -ngs -h”. We also used kseek to search for tandem repeats in the male Illumina reads.
-
bioRxiv - Cell Biology 2020Quote: ... denatured and diluted to 10 pM with pre-chilled hybridization buffer and loaded into TruSeq PE v3 flowcells on an Illumina cBot followed by indexed paired-end sequencing (101 + 7 + 101 bp) on an Illumina HiSeq 2000 using TruSeq SBS Kit v3 chemistry (Illumina). Paired de-multiplexed fastq files were generated using CASAVA software (Illumina ...
-
Ribonuclease Inhibitor and Angiogenin collaboratively regulate cell-type-specific global translationbioRxiv - Biochemistry 2024Quote: ... between 200 ng to 1μg of high-quality RNA (RIN > 7) samples were used for cDNA synthesis and library preparation using the TruSeq Stranded total RNA Sample Preparation kit (Illumina). The cDNA libraries were then sequenced with 2 × 150 bp reads on an Illumina HiSeq3000 instrument ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3’ end adenylation per the TruSeq protocol (Illumina, Inc.), libraries were constructed using an Apollo 324 automated library system ...
-
bioRxiv - Molecular Biology 2019Quote: ... v1.5 small RNA 3’ adaptor kit (Illumina FC-102-1009) or by using TruSeq directional small RNA kit (Illumina RS-200-0012) ...
-
bioRxiv - Genomics 2019Quote: ... the sequence 3’ of the indices were bound by Illumina’s Sequencing Primers ...
-
bioRxiv - Plant Biology 2023Quote: ... with the MiSeq reagent kit version 3 (600 cycles; Illumina). The reads were cleaned up using the cutadapt ver ...
-
bioRxiv - Biophysics 2021Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl Nextera i5 primer (S5xx, Illumina), and 5 μl of a custom i7 primer mix (0.5 μM i7_BCx + 10 μM i7_primer ...
-
bioRxiv - Biophysics 2022Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Biophysics 2023Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples (GJJ_1J) ...
-
bioRxiv - Cancer Biology 2023Quote: With the exception for Whole Transcriptome Amplification Analysis (WTA)7 (sent to Novogene and sequenced on a S4 flowcell of an Illumina Novaseq), all single-cell or bulk sequencing was prepared as ready-made libraries and sequenced either on Illumina Novaseq or Nextseq 500 instruments at the Functional Genomics Center Zurich ...
-
bioRxiv - Immunology 2023Quote: ... Sequencing was performed in 3 sequencing unit of NovaSeq 6000 (Illumina) (100-nt-length reads ...
-
bioRxiv - Immunology 2023Quote: The 3’ adapters were ligated according to the TruSeq kit (Illumina) manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... dual-indexed 3’ DGE libraries were prepared using Nextera XT (Illumina) and sequenced to depth on the NovaseqS4 platform with a paired-end read structure (R1 ...
-
bioRxiv - Genetics 2019Quote: ... An average of 39.7 million 2 x 75 bp paired- end reads were generated for each sample on an Illumina NextSeq 500 (Illumina, Carlsbad, CA). FastQC was used to evaluate the quality of the reads ...
-
bioRxiv - Microbiology 2019Quote: ... which was denatured and run on the MiSeq sequencer at a final concentration of 5 pM alongside a 5 pM PhiX control (Illumina). Raw reads generated by MiSeq were error-corrected and filtered using DADA2 through QIIME2 (https://qiime2.org).38 Filtered reads were clustered de novo into Operational Taxonomic Units (OTUs ...
-
bioRxiv - Microbiology 2021Quote: ... with 5% (v/v) 20 pM PhiX (Illumina), using 150 cycle v3 cartridges ...
-
bioRxiv - Genomics 2019Quote: ... low call rate (> 5% low quality data [Illumina detection P>1×10−6 ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2023Quote: ... In each sequencing run 5% of PhiX (Illumina) was included as an internal control ...
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... corresponding to either the Australian or American samples were pooled and run on 7 lanes of the Illumina NextSeq 500 sequencer (Illumina, San Diego, USA) in 75bp paired-end reads mode.
-
bioRxiv - Molecular Biology 2020Quote: ... was performed using the SureCell WTA 3’ library prep kit (Illumina, 20014279) according to manufacturer’s instructions with minor modifications ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... using 300-cycle kit (v.3, Illumina, Inc., San Diego, CA, USA) to obtain 150 bp paired-end reads.
-
bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ...
-
bioRxiv - Neuroscience 2021Quote: ... 3′ gene expression libraries were dual-index sequenced using NextSeq 150bp (Illumina) flow cells by the Duke Center for Genomic and Computational Biology Core Facility.
-
bioRxiv - Cell Biology 2021Quote: ... The final constructed 3’- biased single cell libraries were sequenced by Illumina Nextseq500 machine ...
-
bioRxiv - Genomics 2021Quote: ... GSA version 3 with direct-to-consumer booster by Illumina (Fig. 1). This Customized chip is the intersection of commonly used chips ...
-
bioRxiv - Immunology 2022Quote: ... and mixed with 3 μl of Illumina TDE1 Tn5 transposase (Illumina, 15027916). Transposition was performed by incubating the prepared reactions on a C1000 Touch thermal cycler with 96–Deep Well Reaction Module (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Microbiology 2023Quote: ... or matched the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Microbiology 2023Quote: ... or matching the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...