Labshake search
Citations for Illumina :
101 - 150 of 364 citations for 3 3 Dimethyl 6 oxa 3 phosphoniabicyclo 3.1.0 hexane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 2-3 ng of DNA was used as input for TruSeq ChIP Library Preparation Kit (Illumina) with following modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA methylation profiling for cohorts 2 and 3 were performed using the Infinium HumanMethylationEPIC BeadChip (Illumina). Sample processing steps and detailed methodology have been described previously [8,14] ...
-
bioRxiv - Developmental Biology 2023Quote: ... 3’ RNA-seq (Bulk MARS-seq91,135) libraries were prepared and sequenced on a Novaseq 6000 (Illumina) at the Weizmann Crown Institute for Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing was performed using the MiSeq Reagent version 3 kit on a MiSeq sequencer (Illumina, USA), at the Research and Production Center for Microbiology and Virology ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were used for the generation of 10X 3’ chromium libraries and sequenced on Novaseq (Illumina).
-
bioRxiv - Immunology 2021Quote: ... The demultiplexing of the raw data was performed using CellRanger software (10x – version 3.1.0; cellranger mkfastq which wraps Illumina’s bcl2fastq). The reads obtained from the demultiplexing were used as the input for ‘cellranger count’ (CellRanger software) ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were submitted for 10x library preparation for 3’ single cell sequencing on a NovaSeq 6000 (Illumina) at the Cancer Research UK Cambridge Institute ...
-
bioRxiv - Genomics 2021Quote: ... and (3) 134 Gb (~100× depth) chromosome conformation capture sequencing (Hi-C) data (sequenced by Illumina platform).
-
bioRxiv - Cancer Biology 2021Quote: ... then multiplexed 3 libraries per lane and sequenced on the Illumina HiSeq4000 sequencer (Illumina, San Diego, CA) using the 75 bp paired end format.
-
bioRxiv - Plant Biology 2020Quote: ... Libraries were pooled and sequenced with 3 runs on the MiSeq using the reagent kit V2 (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... Libraries were pooled at 3 nM and sequenced on a HiSeq X instrument (Illumina, San Diego, CA) to generate 150 bp paired-end reads (Psomagen ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 brain regions per mouse using the TruSeq stranded mRNA LT kit (Cat# RS-122-2101, Illumina). These synthetic RNAs cover a range of concentrations ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... and gene expression levels were determined using Illumina Human WG6 Expression BeadChip Version 3 arrays (Illumina Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter) and alternating reverse oligos (3’ P7 Illumina adapter) ...
-
bioRxiv - Genomics 2020Quote: ... sequencing libraries were prepared from 1 ng gDNA using the Nextera XT Library Preparation Kit v.3 (Illumina) and sequenced on the Illumina NextSeq system (paired end 2 x 150 bp insert size) ...
-
bioRxiv - Bioengineering 2021Quote: ... Additional adapters at 5’-end (P5 and SP1) and 3’-end (P7 and SP2) were designed by Illumina for sequencing purpose ...
-
bioRxiv - Biochemistry 2021Quote: ... PCR products were gel purified in 3% agarose gel and qPCRed (using NEBNext Library Quant Kit for Illumina) to quantify concentration ...
-
bioRxiv - Genomics 2021Quote: ... Single-cell libraries were prepared using the SureCell WTA 3’ Library Prep Kit for the ddSEQ System (Illumina). The quality of the libraries was assessed using the Agilent 2100 Bioanalyzer ...
-
bioRxiv - Neuroscience 2022Quote: ... Gene expression and barcode libraries were prepared in parallel using the Chromium Next GEM Single Cell 3’ Kit v3.1 (10x Genomics) according to manufacturer’s instructions and sequenced in a Novaseq 6000 system (Illumina). A detailed step-by-step protocol can be found on protocols.io ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were prepared using the QuantSeq 3′mRNA-Seq Library Prep Kit-FWD by Illumina (Lexogen, Vienna, Austria), using 500 ng of total RNA ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNAs were prepared using the single cell 3’ Protocol as per manufacturer’s instructions and sequenced on a NextSeq 500 instrument (Illumina) or NovaSeq instrument (Illumina ...
-
bioRxiv - Immunology 2022Quote: ... Sequencing libraries were prepared using the Chromium Single Cell 3’ v2 kit and sequenced on a HiSeq system (Illumina) at Institut Curie NGS facility ...
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Microbiology 2020Quote: ... 3 to 12 µl of extracted RNA was depleted of rRNA using Ribo-Zero Gold H/M/R (Illumina) and then reverse-transcribed using random hexamers and SuperScript IV (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: 3′-scRNAseq was completed using Chromium Next GEM single cell 3′ GEM library and Gel bead Kit v3.1 (10x Genomics) and sequenced using a NextSeq 500 (Illumina) at Genomics Birmingham (University of Birmingham) ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by library preparation according to the manufacturer’s recommendations (Single Cell 3’ V3 assay) and sequencing on a HiSeq4000 instrument (Illumina). Libraries were de-multiplexed ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... The full-length cDNA were synthesized using the Chromium Next GEM Single Cell 3’ Reagent Kits v3.1 and sequenced by Illumina HiSeq X Ten platform by Gene Denovo Biotechnology Co ...
-
bioRxiv - Physiology 2022Quote: ... cDNAs were prepared using the single cell 3’ Protocol as per manufacturer’s instructions and sequenced on a NovaSeq 6000 (Illumina) with 26 bases for read1 and 98×8 bases for read2.
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng RNA was prepared with a commercially available kit according to the manufacturer’s instruction (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina ...
-
bioRxiv - Immunology 2020Quote: ... We diluted the final library to 3 nM concentration and used a HiSeq PE150 sequencer (Illumina, San Diego, CA) to perform the sequencing.
-
bioRxiv - Evolutionary Biology 2021Quote: ... DNA sequencing was performed on an Illumina MiSeq at RBGK with version 3 chemistry (Illumina, San Diego, CA, USA) and ran for 600 cycles to generate 2 × 300 bp paired-end reads ...
-
bioRxiv - Pathology 2021Quote: ... Single cell transcriptome libraries of liver cells were prepared with Chromium Single Cell 3’ NextGEM Reagent Kit v3.1 (10X Genomics) to performed sequencing on NextSeq 550 (Illumina) and demultiplexing pipeline with CellRanger v5.0.0 (10x Genomics) ...
-
bioRxiv - Microbiology 2022Quote: ... Short-read sequencing of strain 3-1B was conducted on the Illumina MiSeq platform (Illumina, San Diego, CA, USA) using the NEBNext Ultra II FS DNA library prep kit (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... The library was spiked with 10% of 12.5 pM PhiX and sequenced using 150 cycles of MiSeq version 3 chemistry (Illumina).
-
bioRxiv - Immunology 2024Quote: ... Gene expression and surface protein libraries were generated using the Chromium Next GEM Single Cell 3 ’Reagent Kits v3.1 and sequenced by Illumina MiSeq or NextSeq2000 ...
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were prepared according to the manufacturer’s protocol using 10X Single-Cell 3’ v3.1 chemistry (10X Genomics, PN-1000128) and sequenced on the NovaSeq platform (Illumina).
-
bioRxiv - Cell Biology 2023Quote: ... The snRNA-seq library were constructed with 10x Genomic protocol (Chromium Single Cell 3’ Reagent Kits v3.1User Guide) and sequenced by Illumina NovaSeq.
-
bioRxiv - Immunology 2023Quote: ... using the Chromium Single Cell Gene Expression Solution 3’ v2 (10x Genomics) and sequenced by the DNA Sequencing Facility (RRID: SCR_017759) using NovaSeq6000 (Illumina) with read lengths of 29-bp + 90-bp (Read1 + Read2) ...
-
bioRxiv - Microbiology 2023Quote: Metagenomic shotgun sequencing was performed at the Norwegian Sequencing Centre on two lanes of the HiSeq 3/4000 (Illumina) generating 150 bp paired-end reads in both lanes ...
-
THE OLFACTORY RECEPTOR Olfr78 REGULATES DIFFERENTIATION OF ENTEROCHROMAFFIN CELLS IN THE MOUSE COLONbioRxiv - Cell Biology 2023Quote: ... before processing through the Chromium Next GEM Single Cell 3’ Reagent Kits V3.1 (10X Genomics) and sequenced on a Novaseq 6000 (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... was constructed using the QuantSeq 3’ mRNA-seq FWD kit (Lexogen) and the UMI Second Strand Synthesis Module (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Gel-in-beads and libraries were generated using Chromium Next GEM Single Cell 3’ Reagent Kits v3.1 (10x Genomics) and sequenced using NovaSeq (Illumina). Cell Ranger 7.0.1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were submitted for 10x library preparation with v3.0 chemistry for 3’ single-cell sequencing on a NovaSeq 6000 (Illumina) at the Cancer Research UK Cambridge Institute.
-
bioRxiv - Cancer Biology 2024Quote: ... Single-cell libraries were generated using 10X Genomics Chromium Single-cell 3’ Library RNA-Seq Assays protocols targeting 8,000 cells from each fraction were sequenced on the NovaSeq sequencer (Illumina). The scRNA-seq data were analyzed with the Partek Flow software (Partek Inc) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were submitted for 10x library preparation with v3.0 chemistry for 3’ single-cell sequencing on a NovaSeq 6000 (Illumina) at the Cancer Research UK Cambridge Institute.
-
bioRxiv - Genetics 2024Quote: ... cDNA libraries were constructed using the QuantSeq 3′ mRNA-Seq Library Prep Kit FWD (Illumina, Lexogen GmbH, Vienna, Austria) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA sequencing was performed by the High Throughput Sequencing Core (CHOP) using a standard 3’ assay with the NovaSeq 6000 platform and S1 Reagent Kit v1.5 (Illumina).