Labshake search
Citations for Illumina :
101 - 150 of 2339 citations for 2R 5S 5 4 amino 5 fluoro 2 oxopyrimidin 1 2H yl 1 3 oxathiolan 2 yl methyl butyrate WXC04778 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl transposase (Illumina), 10.5 μl nuclease-free water and 0.01% NP-40 ...
-
bioRxiv - Immunology 2021Quote: ... Group 2 (France, Illumina), Group 3 (North America ...
-
bioRxiv - Microbiology 2022Quote: ... 2 (Illumina, CA, USA). ASVs were inferred using DADA2 v ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 from Illumina libraries.
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Molecular Biology 2020Quote: ... Small RNA-seq libraries for 2–4 biological samples were sequenced together using a NextSeq 500 (Illumina) to obtain 75 nt ...
-
bioRxiv - Genetics 2020Quote: ChIP-seq and DNase-seq libraries were prepared from 1-5 ng ChIP DNA or DNase DNA samples using NEBNext Ultra II DNA library Prep Kit (Illumina). Libraries were sequenced on an Illumina NextSeq 500 with single-end or paired-end 75 bp reads.
-
bioRxiv - Genomics 2021Quote: ... Following immunoprecipitation with Dynabeads Protein G beads (invitrogen) in PCR tubes, samples were subject to Tagmentation (5 µl Tagmentation Buffer, 1 µl Tagmentation DNA Enzyme (Illumina), 19 µl Nuclease free water ...
-
bioRxiv - Systems Biology 2020Quote: ... Sequencing was performed using custom read primer oligo1210 (5’-CTTGTGGAAAGGACGAAACACCGGTAATTTCTACTCTTGTAGAT) (HPLC purified, Integrated DNA Technologies) using NextSeq 1 × 75 nt High Output reagents (Illumina).
-
bioRxiv - Immunology 2020Quote: ... Use of 250 pg of cDNA with 1/5 reaction of Illumina Nextera XT kit (Illumina, San Diego, CA, USA). The length distribution of the cDNA libraries was monitored using DNA High Sensitivity Reagent Kit on the Perkin Elmer Labchip GX system (PerkinElmer ...
-
bioRxiv - Genetics 2021Quote: ... The bone and reference captured library pools were diluted to 1 pM with a 5% spike-in of PhiX Control V3 (Illumina) for sequencing on a NextSeq 550 (Illumina ...
-
bioRxiv - Immunology 2024Quote: ... the antibody barcode library was pooled at a ratio of 1:5 with the gene expression library and sequenced on a NextSeq 2000 (Illumina) to an average depth of 34,000 reads per cell.
-
bioRxiv - Cancer Biology 2023Quote: RNA-seq libraries were prepared with 0,5-1 µg of total high quality RNA collected from samples and the Illumina Stranded Total RNA Prep kit (Illumina) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... The flow cell was loaded with 5 picomolar pooled libraries containing 5% PhiX control V3 (Illumina). Raw sequencing data were demultiplexed with Bcl2Fastq software (v2.19 ...
-
bioRxiv - Microbiology 2024Quote: ... with 5% PhiX loading control (Illumina).
-
bioRxiv - Genomics 2024Quote: ... with 5% PhiX spike-in (Illumina).
-
bioRxiv - Cancer Biology 2024Quote: ... with 5% PhiX library control (Illumina). Autosmal ranged from 23X to 29X ...
-
bioRxiv - Genomics 2021Quote: ... We collected nuclei by centrifuging at 500 g at 4°C and resuspended nuclei in 5 ul TD buffer with 2.5 ul Tn5 enzyme (Illumina Tagment DNA TDE1 Enzyme and Buffer Kits) ...
-
bioRxiv - Genetics 2022Quote: ... Nuclei pellet was obtained by centrifugation at 500g for 5 minutes at 4 degrees and resuspended in 100μl ice-cold 1x TD buffer (20034198, Illumina). About 10K nuclei was used for transposition reaction at 37 degrees for 30 minutes in a thermomixer ...
-
bioRxiv - Cancer Biology 2021Quote: ... adding Illumina sequencing adapters and dual-index barcodes (index 1(i7) and index 2(i5)) (Illumina, San Diego, CA) to the amplicon target ...
-
bioRxiv - Immunology 2023Quote: ... The samples were sequenced in a paired-end run (read 1: 28bp, read 2: 91bp) on a NovaSeq6000 platform using S1 v1.5 (100 cycles) sequencing kits (Illumina). Bcl2fastq software (v2.20.0.422 ...
-
bioRxiv - Cancer Biology 2022Quote: ... using primers DCF01 5’-CTTGTGGAAAGGACGAAACACCG-3’ and DCR03 5’-CCTAGGAACAGCGGTTTAAAAAAGC-3’ and subjected to single-end 75 bp (SE75) high-throughput sequencing using a NextSeq550 (Illumina).
-
bioRxiv - Developmental Biology 2020Quote: ... and two different mate-pair libraries (3 kb and 5 kb) were prepared with a Nextera Mate Pair Library Prep Kit (Illumina). Sequencing libraries were run on the Illumina Hiseq 2500 sequencer with a read length of 150 bp ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... The rRNA-depleted samples were used for TruSeq Stranded RNA Sample Prep kit to produce 5′ to 3′ strand-specific cDNA libraries (Illumina). A TruSeq SBS sequencing kit version 3 (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... Illumina sequencing libraries were indexed with unique 5’ and 3’ barcode combinations (up to 384 cells) using the Nextera XT DNA library preparation kit (Illumina). Libraries were pooled and size-selected with 0.9X AmpPure XP beads ...
-
bioRxiv - Microbiology 2023Quote: ... 3-5 µg of each sample was treated with Ribozero® rRNA Removal Kit according to the manufacturer’s instructions (Illumina, USA ...
-
bioRxiv - Microbiology 2023Quote: ... The transposon-specific primer was designed to include (from 5’ to 3’): (i) the “P5” or “P7” flow-cell annealing sequence (Illumina), (ii ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA was dephosphorylated in 3’ and then phosphorylated in 5’ to generate cDNA libraries using the NebNext Small RNA Sample Prep kit with 3’ sRNA Adapter (Illumina) according to the manufacturer’s protocol with 12 cycles of PCR amplification in the last step followed by DNA purification with Monarch PCR DNA cleanup kit (NEB) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... High-throughput genome sequencing was performed either on Hiseq 2000 (2 × 100 or 2 × 150 paired-end reads) or Miseq (2 × 300 paired-end reads) sequencer (Illumina, San Diego, CA) following the manufacturer ‘s instruction.
-
bioRxiv - Physiology 2021Quote: ... High-throughput genome sequencing was performed on a HiSeq 2500 (2 × 100 or 2 × 150 paired-end reads) or MiSeq (2 × 300 paired-end reads) sequencer (Illumina, San Diego, CA), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... The 33 samples were combined into 2 pools and sequenced using 2 NovaSeq (Illumina) S4 200 cycle flow cells.
-
bioRxiv - Cancer Biology 2021Quote: ... Each well contained 10 μL tagmentation buffer (5 μL NIB and 5 μL TD buffer from Illumina). For the second sort plate ...
-
bioRxiv - Cell Biology 2024Quote: ... After 2-3 passages in complete DMEM with 10% FBS gDNA was extracted to confirm the genotype by Illumina amplicon sequencing and live cell microscopy was performed.
-
bioRxiv - Cell Biology 2020Quote: ... and D (v.2, Illumina) and sequenced on HiSeq4000 and NovaSeq6000 (Illumina ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μl Tn5 enzyme (Illumina), 0.25 μl 1 % digitonin ...
-
bioRxiv - Genetics 2023Quote: 2×150bp reads from Illumina NovaSeq were obtained for all samples with a minimum depth of 22M reads at Novogene (Beijing ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2) Detection from Illumina RNA-seq data through SL leader sequence trimming(43) ...
-
bioRxiv - Genetics 2023Quote: 2×150bp reads from Illumina NovaSeq were obtained for all samples with a minimum depth of 17 M reads at Novogene (Beijing ...
-
bioRxiv - Cell Biology 2024Quote: ... The hashtag cDNA and endogenous cDNA libraries were diluted to 4 nM and pooled (5% hashtag + 95 % endogenous cDNA) before being sequenced on a NextSeq2000 sequencer (Illumina).
-
bioRxiv - Cell Biology 2023Quote: ... The hashtag cDNA and endogenous cDNA libraries were diluted to 4 nM and pooled (5% hashtag + 95% endogenous cDNA) before being sequenced on a NextSeq2000 sequencer (Illumina).
-
bioRxiv - Genetics 2021Quote: ... Libraries were sequenced by NextSeq 550 High Output with 21 bp for read 1 and 72 bp for read 2 (Illumina). Sequenced reads were aligned using STAR (v2.7.6a ...
-
bioRxiv - Microbiology 2020Quote: ... pooled with 1% denatured PhiX DNA (sequencing control) and sequenced in a MiSeq platform (2× 251 cycles paired-end run; Illumina). New PCR reactions using combinations of the primers described above were carried out to cover regions with low coverage for each sample ...
-
bioRxiv - Systems Biology 2020Quote: ... then performed paired-end sequencing of these libraries (38 cycles read 1 + 37 cycles read 2) on a NextSeq 500 (Illumina). After sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... 8 bases for index 1 and 8 bases for index 2) using the NextSeq 500 High Output Kit 75-cycles (#FC-404-1005, Illumina) loaded at 1.8pM and including 1 % PhiX ...
-
bioRxiv - Immunology 2022Quote: ... TCRseq libraries were sequenced on an Illumina Novaseq 6000 SP flowcell (67 bp read 1 and 459 bp read 2) (Illumina) to a depth of approximately 20,000 reads.
-
bioRxiv - Immunology 2022Quote: ... Targeted RNAseq and Sample Tag libraries were sequenced on an Illumina Novaseq 6000 S4 flowcell (67 bp read 1 and 140 bp read 2) (Illumina) to a depth of approximately 40,000 reads and 10,000 reads per cell ...
-
bioRxiv - Immunology 2022Quote: ... whose lengths were about 600 base pairs were sequenced using an Illumina Novaseq 6000 S4 flowcell (67 bp read 1 and 140 bp read 2) (Illumina). Only read2 contained the sequence regarding the definition of T cell clones.